Aizoanthemopsis hispanica

(L.) Klak · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Aizoanthemopsis

At a glance

Occurrence records1 241

Data sources8

Biological traits36

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Aizoanthemopsis hispanica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Occurrence & distributionGBIF1 241 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Aizoanthemum hispanicum, or Spanish aizoon, is a species of plant in the family Aizoaceae. It is native to northern Africa, the Mediterranean region and the Middle East where it grows on arid sandy plains, saline areas and in semi-arid habitats. It was first described as Aizoon hispanicum by the Swedish naturalist Carl Linnaeus in 1753 and was in 2002 placed in the genus Aizoanthemum by the German botanist Heidrun Hartmann.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length max10 mm

Fruit width max20 mm

Leaf length max10 mm

Leaf width max6.2 mm

Plant height max0.25 m

Plant height min0.05 m

Seed length max1 mm

Seed length min0.75 mm

Seed mass7.9 mg

Seed mass max31.12 mg

Seed mass min0.127 mg

Life cycle & reproduction9

Dehiscencedehiscent

Flower colourwhite

Flower length max15 mm

Flower length min7 mm

Flowering endMay

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Habitat GIFTdesert, saline places, semidesert

Leaf formelliptic

Succulenceyes

Woodinessvariable

⚠ sources differ — TRY: woody/nonwoody · GIFT: non-woody

Other traits5

Leaf arrangementalternate

Plant support typefree-standing

Shoot length max25 cm

Shoot length min5 cm

Shoot orientationascending

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aizoanthemopsis hispanica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX281964.1 ↗436 bpKuwait

ACGT

GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCNAGTTGCGCCCGAAGCCCTCGGGCCTAGGGCACGTCTGCATGGGCG …

Aizoanthemopsis hispanica voucher EDNA15-0042789 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aizoanthemopsis hispanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — PERUZZI L., CESCA G. - 2004. Chromosome numbers of flowering plants from Calabria, S Italy. II. Willdenowia , 34(2): 353-360.

CCDB · ipcn-api-dl — Peruzzi. 2004. Chromosome numbers of flowering plants from Calabria, S Italy, II. Willdenowia 34: 353–360.

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bittrich, V. 1986. Untersuchungen zu Merkmalsbestand, Gliederung und Abgrenzung der Unterfamilie Mesembryanthemoideae (Mesembryanthemaceae Fenzl). Mitt. Inst. Allg. Bot. Hamburg 21: 5–116.

08Occurrence & distribution

Record type1 241 records

Wild obs. + sensor1 221

Museum / vouchered18

Other2

Range

Area of Occupancy AOO2 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 302≤1 km 56≤10 km 96>10 km 20

474 georeferenced · 747 without coordinates

Open the mapobservation + sensor1 221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	14
Wlocation not on record	3
Rishon Le Zion, IL	1

3 institutions · 18 of 18 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Aizoanthemopsis hispanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aizoanthemopsis hispanica

At a glance

Sources8 archives

Size & morphology11

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Other traits5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 241 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 241 records