Aithorape roseicornis

(Dognin, 1899) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Megalopygidae/Aithorape

At a glance

Occurrence records218

Data sources6

Biological traits0

DNA specimens17

eDNA detections16

Sources6 archives

Databases and archives Aithorape roseicornis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF218 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

Aithorape flammicornis is a moth of the Megalopygidae family. It was described by Schaus in 1905. It is found in Brazil, Trinidad, Guyana, French Guiana and Venezuela.Ergebnisse einer zoologischen Sammelreise nach Brasilien, insbesondere in das Amazonasgebiet, ausgeführt von Dr. H. Zerny The wingspan is about 27 mm. The body is white and the tarsi, mid- and fore tibiae are black and there is a dark spot on the fore coxae. The frons is dark brown and grey and the antennae are red. The wings are white, with the costa of the forewings finely black.Proceedings of the United States National Museum - Descriptions of new South American moths

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aithorape roseicornis has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BINs2

Most divergent pair1.4%

Where individuals differ — all 9 variable positions, in barcode order

38Cmostly conserved

50Cmostly conserved

157Cmostly conserved

178Cmostly conserved

202Tmostly conserved

263Tmostly conserved

268Gmostly conserved

352Amostly conserved

646Cmostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCAGGTTTACTAGGTACATCACTAAGAATATTAATCCGAACAGAATTAGGTAATCCAAGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bleptina confusalissame order11.9%Dichomeris punctidiscellussame order11.9%Lacosoma oyapocasame order11.9%Eremochroa lunatasame order12.3%Paysandisia archonsame order12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type218 records

Wild obs. + sensor19

Museum / vouchered199

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 5≤1 km 5≤10 km 1>10 km 3

14 georeferenced · 5 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 199 records without

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	194
University of Pennsylvanialocation not on record	3
Cornell University Insect Collectionlocation not on record	1

3 institutions · 198 of 199 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Aithorape roseicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 24.4–26.0

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.6 °C 27.1–28.1

Min temp (night)23.6 °C 22.1–24.5

Precipitation151 mm/mo 151–378

Air humidity66.1 % 65.1–71.0

Moisture balance-11.9 mm/mo

Vapour deficit1,098 Pa 895–1,166

Wind speed4.10 m/s

Cloud cover29.0 % 29.0–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)