Aiteta iridias

(Meyrick, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nolidae/Aiteta

At a glance

Occurrence records76

Data sources6

Biological traits0

DNA specimens19

eDNA detections19

Sources6 archives

Databases and archives Aiteta iridias's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Aiteta iridias is een vlinder uit de familie van de visstaartjes (Nolidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1889 door Meyrick.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aiteta iridias has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

34Tmostly conserved

49Tmostly conserved

67Gmostly conserved

88Tmostly conserved

178Tmostly conserved

212Cmostly conserved

263Cmostly conserved

313Cmostly conserved

364Amostly conserved

409Amostly conserved

499Tvariable

514Tmostly conserved

520Gmostly conserved

562Cmostly conserved

589Tmostly conserved

615Amostly conserved

616Tmostly conserved

634Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGTCTTTTAATTCGGGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes8

BINs3

Most divergent pair3.0%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xenochroa purpureasame family6.7%Aiteta trigoniphorasame genus6.8%Carea internifuscasame family6.8%Siglophora ferreiluteasame family7.0%Savoca xistasame order7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type76 records

Wild obs. + sensor59

Museum / vouchered17

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 8≤1 km 34≤10 km 7>10 km 3

52 georeferenced · 7 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tallinn, EE	4
Museums Victorialocation not on record	3
Sydney, AU	1

3 institutions · 8 of 17 vouchered records shown · 9 without an institution code

09Environmental DNA19 detections

Where the DNA of Aiteta iridias was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 21.2–27.3

Seasonal swing summer↔winter6.50 °C

Max temp (day)26.0 °C 24.3–32.6

Min temp (night)21.8 °C 18.7–24.4

Precipitation142 mm/mo 6.30–310

Air humidity62.4 % 46.5–65.3

Moisture balance9.40 mm/mo

Vapour deficit1,182 Pa 888–1,681

Wind speed3.60 m/s

Cloud cover42.0 % 26.1–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)