Aiolopus puissanti

Defaut, 2005 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Aiolopus

At a glance

Occurrence records6 153

Data sources8

Biological traits0

DNA specimens5

eDNA detections2

Sources8 archives

Databases and archives Aiolopus puissanti's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 153 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Aiolopus puissanti is a species of band-winged grasshopper in the family Acrididae. It is found in southern Europe and northern Africa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aiolopus puissanti has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACCTTATACTTTATATTTGGAGCATGAGCAGGAATAGTAGGAACGTCAATAAGAATGATTATTCGTGCAGAATTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aiolopus thalassinussame genus6.7%Aiolopus simulatrixsame genus10.2%Sphingonotus yenchihensissame family11.9%Epacromius tergestinussame family12.0%Epacromius pulverulentussame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 153 records

Wild obs. + sensor6 117

Museum / vouchered35

Other1

Range

Area of Occupancy AOO8 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 779≤1 km 1 855≤10 km 1 285>10 km 123

5 042 georeferenced · 1 075 without coordinates

Open the mapobservation + sensor6 117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 6≤1 km 9≤10 km 15

30 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museu Nacional de História Natural e da Ciêncialocation not on record	23
CIBIOlocation not on record	4
Museum national d'Histoire naturellelocation not on record	1

3 institutions · 28 of 35 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Aiolopus puissanti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

Ronciers en bord de ripisylves

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 15.5–17.9

Seasonal swing summer↔winter17.9 °C

Max temp (day)20.0 °C 19.9–20.1

Min temp (night)12.5 °C 9.70–15.3

Precipitation56.7 mm/mo 38.1–75.3

Air humidity57.0 % 53.7–60.4

Moisture balance-37.4 mm/mo -56.8–-17.9

Vapour deficit880 Pa 821–939

Wind speed3.10 m/s 2.20–3.90

Cloud cover41.5 % 38.9–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aiolopus puissanti

At a glance

Sources8 archives

At a glance

Record type6 153 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 153 records