Aidablennius sphynx

(Valenciennes, 1836) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Blenniidae/Aidablennius

At a glance

Occurrence records2 091

Data sources12

Biological traits4

DNA specimens10

eDNA detections10

Sources12 archives

Databases and archives Aidablennius sphynx's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 007 records↗

OBISOcean Biodiversity Information System84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 091 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT · NCBI597 Mbp

01Narrative

The sphinx blenny (Aidablennius sphynx) is a species of combtooth blenny, and the only species in the genus Aidablennius.Species in the genus Aidablennius at www.fishbase.org. It was described by Achille Valenciennes in 1836, originally under the genus Blennius,Cuvier, G. and A. Valenciennes, 1836 (July) [ref. 1005] Histoire naturelle des poissons. Tome onzième. Livre treizième. De la famille des Mugiloïdes. Livre quatorzième. De la famille des Gobioïdes. Histoire naturelle des poissons v. 11: i-xx + 1-506 + 2 pp., Pls. 307-343. and was later reassigned under "Aidablennius" by Gilbert Percy Whitley in 1947. It is a subtropical blenny known from Morocco, in the eastern Atlantic Ocean, and also from the Mediterranean and Black Seas.Aidablennius sphynx at www.fishbase.org. Sphinx blennies inhabit shallow, rocky waters in the littoral zone, with sunlight exposure. They feed primarily on benthic algae, weeds and invertebrates.Food items for Aidablennius sphynx at www.fishbase.org. Sphinx blennies can measure up to 8 cm long in total length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aidablennius sphynx has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P602 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

14Cmostly conserved

40Gmostly conserved

43Gmostly conserved

69Amostly conserved

79Cmostly conserved

108Tmostly conserved

124Gmostly conserved

163Tmostly conserved

178Gmostly conserved

302Cmostly conserved

397Tmostly conserved

475Avariable

494Tmostly conserved

496Amostly conserved

527Amostly conserved

533Cmostly conserved

540Cmostly conserved

598Tmostly conserved

TGCCCTTAGCCTTCTAATTCGGGCCGAACTAAGCCAACCGGGGTCTCTTCTTGGTGACGATCAACTGTATAATGTAATCGTAACCGCACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes3

BIN1

Most divergent pair0.33%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scartella emarginatasame family16.1%Coryphoblennius galeritasame family16.1%Stiphodon surrufussame order16.3%Ecsenius opsifrontalissame family16.4%Stiphodon hydoreibatussame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aidablennius sphynx carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size596 580 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aidablennius sphynx0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×GoaT · Animal Genome Size Database

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~46.5 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin46.5 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 091 records

Wild obs. + sensor1 853

Museum / vouchered234

Other4

Origin

Native39

Range

Area of Occupancy AOO3 100 km²

Depth

0–200 m sunlit43

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 95.4 m · 43 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 972≤1 km 502≤10 km 112>10 km 17

1 603 georeferenced · 250 without coordinates

Open the mapobservation + sensor1 853

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 31≤1 km 4≤10 km 16>10 km 3

54 georeferenced · 180 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	81
	23
National Natural History Collectionslocation not on record	19
Paris, FR	14
New Haven, US	13
FishBaselocation not on record	8
SNSB-Zoologische Staatssammlung Münchenlocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
CASlocation not on record	2
University of California San Diegolocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Helsinki, FI	1
Moore Laboratory of Zoology, Occidental Collegelocation not on record	1
Toronto, CA	1
South African Institute for Aquatic Biodiversitylocation not on record	1

15 institutions · 176 of 234 vouchered records shown · 6 without an institution code

09Environmental DNA10 detections

Where the DNA of Aidablennius sphynx was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.10 °C 7.90–12.1

Seasonal swing summer↔winter16.3 °C

Max temp (day)9.70 °C 9.60–16.4

Min temp (night)5.50 °C 3.20–8.50

Precipitation157 mm/mo 42.3–221

Air humidity57.0 % 54.3–59.6

Moisture balance171 mm/mo

Vapour deficit460 Pa 440–708

Wind speed2.70 m/s

Cloud cover61.9 % 34.3–63.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aidablennius sphynx

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type2 091 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 091 records