Aguriahana stellulata

(Burmeister, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Aguriahana

At a glance

Occurrence records522

Data sources7

Biological traits2

DNA specimens53

eDNA detections59

Sources7 archives

Databases and archives Aguriahana stellulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility522 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF522 records

Environmental DNA2 datasets · 6 countries59 detections

DNA & barcodingBOLD53 specimens

01Narrative

Aguriahana stellulata is a species of true bug belonging to the family Cicadellidae. It is native to Europe and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aguriahana stellulata has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

eDNA detections59

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

10Cmostly conserved

145Cmostly conserved

206Amostly conserved

625Gmostly conserved

AACAATGTACTTTATTTTTGGAGTATGAGCTGGAATAGTAGGAATAATAATAAGAATATTGATTCGAATTGAATTAGCACAACCTGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes6

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Typhlocyba niobesame family16.4%Xestocephalus desertorumsame family16.7%Xestocephalus superbussame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type522 records

Wild obs. + sensor346

Museum / vouchered173

Other3

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 192≤1 km 58≤10 km 72

322 georeferenced · 24 without coordinates

Open the mapobservation + sensor346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 28≤1 km 13≤10 km 69

110 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	51
Helsinki, FI	27
Oregon State University, Department of Fisheries Wildlife's Birds, Mammals, and Fishes Collectionslocation not on record	17
Philadelphia, US	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Tartu, EE	4
SLU Artdatabankenlocation not on record	4
Museo universitario di Scienze della Terra di Romalocation not on record	3
MZLUlocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
neflocation not on record	1

11 institutions · 134 of 173 vouchered records shown · 39 without an institution code

09Environmental DNA59 detections

Where the DNA of Aguriahana stellulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys2

Countries6

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map6 countries0

ForestUrbanfarmTemperate mixed forest1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 16.7–20.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)24.8 °C 20.8–25.7

Min temp (night)15.0 °C 12.8–16.0

Precipitation95.4 mm/mo 75.2–97.2

Air humidity58.4 % 57.6–60.0

Moisture balance-63.0 mm/mo -64.6–-36.0

Vapour deficit925 Pa 761–1,016

Wind speed3.20 m/s 2.70–3.80

Cloud cover39.8 % 38.7–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 58 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)