Aguna coeloides

Austin & Mielke, 1998 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Aguna

At a glance

Occurrence records18

Data sources4

Biological traits0

DNA specimens24

eDNA detections20

Sources4 archives

Databases and archives Aguna coeloides's data was compiled from.

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD24 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aguna coeloides has left across the world's sequence archives.

At a glance

DNA specimens24

BINs3

Marker genes1

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

38Amostly conserved

163Cmostly conserved

196Gmostly conserved

211Gmostly conserved

212Cmostly conserved

304Tvariable

317Gmostly conserved

337Amostly conserved

361Cmostly conserved

619Amostly conserved

634Tmostly conserved

637Tmostly conserved

641Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAATTGGAACTTCATTAAGATTACTTATTCGTACTGAATTAGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes4

BINs3

Most divergent pair6.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aguna coelussame genus4.4%Aguna asandersame genus5.0%Aguna auruncesame genus5.5%Aguna metophissame genus5.6%Aguna aruncesame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type18 records

Wild obs. + sensor8

Museum / vouchered10

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 3

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	3
Smithsonian Tropical Research Institutelocation not on record	2
University of Pennsylvanialocation not on record	1

3 institutions · 6 of 10 vouchered records shown · 4 without an institution code

09Environmental DNA20 detections

Where the DNA of Aguna coeloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 23.4–26.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.6 °C 25.6–29.5

Min temp (night)22.2 °C 21.1–23.7

Precipitation269 mm/mo 58.1–469

Air humidity69.3 % 63.4–75.0

Moisture balance130 mm/mo -108–334

Vapour deficit927 Pa 717–1,221

Wind speed2.70 m/s 1.50–3.40

Cloud cover30.9 % 13.7–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)