Aguna claxon

Evans, 1952 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Aguna

At a glance

Occurrence records139

Data sources9

Biological traits0

DNA specimens21

eDNA detections20

Sources9 archives

Databases and archives Aguna claxon's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · NCBI≈221 Mbp

01Narrative

Aguna claxon, the emerald aguna, is a species of dicot skipper in the butterfly family Hesperiidae. It is found in Central America, North America, and South America. The MONA or Hodges number for Aguna claxon is 3877.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aguna claxon has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

106Cvariable

151Tvariable

259Cvariable

346Cvariable

500Tvariable

514Tvariable

544Cvariable

589Tvariable

596Tvariable

628Gvariable

AACTTTATATTTTATCTTTGGAATTTGAGCTGGTTTAGTTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes3

BINs2

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aguna asandersame genus6.2%Thorybes lyciadessame family7.1%Aguna metophissame genus7.1%Aguna coelussame genus7.1%Aguna auruncesame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aguna claxon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈220 902 713 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aguna claxon0.22 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type139 records

Wild obs. + sensor63

Museum / vouchered76

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 19≤1 km 9≤10 km 13>10 km 6

47 georeferenced · 16 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 31

31 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	31
FLMNH-UFlocation not on record	18
Tapachula, MX	13
Ciudad de México, MX	4
University of Pennsylvanialocation not on record	2
National Biodiversity Institute, Costa Ricalocation not on record	2

6 institutions · 70 of 76 vouchered records shown · 6 without an institution code

09Environmental DNA20 detections

Where the DNA of Aguna claxon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.7–26.3

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 26.3–30.1

Min temp (night)22.0 °C 20.0–23.1

Precipitation418 mm/mo 50.3–427

Air humidity75.5 % 59.5–76.4

Moisture balance288 mm/mo -42.8–299

Vapour deficit743 Pa 700–1,200

Wind speed1.50 m/s 1.20–2.30

Cloud cover38.7 % 28.5–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)