Aguarunichthys torosus

Stewart, 1986 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Pimelodidae/Aguarunichthys

At a glance

Occurrence records9

Data sources7

Biological traits4

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Aguarunichthys torosus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Aguarunichthys torosus, the Bolt Catfish or Yellow-band Catfish, is a species of benthopelagic catfish of the family Pimelodidae that is native to Cenepa River basin in Amazon River drainage of Peru. It is only found in Río Marañón in the upper Amazon basin of Peru. It grows to a length of 346 mm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length34.6 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability32.21

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aguarunichthys torosus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.27%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

429Amostly conserved

470Amostly conserved

567Cvariable

AAAGACATTGGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTGGCACAGCTCTTAGCCTACTAATTCGGGCAGAGCTAGCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachyplatystoma vaillantiisame family11.6%Brachyplatystoma filamentosumsame family11.9%Pimelodina flavipinnissame family12.1%Pimelodus pictussame family12.2%Sorubimichthys planicepssame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 records

Wild obs. + sensor3

Museum / vouchered6

Origin

Native1

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FishBaselocation not on record	1
Toronto, CA	1
Los Angeles, US	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1

4 institutions · 4 of 6 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Aguarunichthys torosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 24.5–26.2

Seasonal swing summer↔winter1.40 °C

Max temp (day)29.5 °C 28.1–29.5

Min temp (night)23.8 °C 21.2–23.8

Precipitation289 mm/mo 194–289

Air humidity70.2 % 66.0–70.2

Moisture balance156 mm/mo 71.1–156

Vapour deficit1,008 Pa 1,008–1,041

Wind speed0.9 m/s 0.9–1.20

Cloud cover41.1 % 41.1–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)