Agrotis malefida

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records1 124

Data sources7

Biological traits0

DNA specimens11

eDNA detections16

Sources7 archives

Databases and archives Agrotis malefida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 124 records

Environmental DNA1 datasets · 4 countries16 detections

DNA & barcodingBOLD11 specimens

01Narrative

Agrotis malefida, the rascal dart or palesided cutworm, is a moth of the family Noctuidae. It is found from North Carolina and Kentucky south to Florida, west to Arizona, and north to southern Kansas. It is also found in the Neotropics from Mexico to Argentina and Chile. The wingspan is 40 –. The length of the forewings is 18 –. Adults emerge in late January in the northern part of its range, in the south they fly throughout the year. The larvae feed on a wide range of broad-leaved herbaceous plants, including Brassica oleracea, Trifolium, Fabaceae, Allium, Pisum sativum, Capsicum, Solanum tuberosum, Nicotiana, Solanum lycopersicum as well as various weeds. It is considered a pest on Zea mays and Gossypium.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis malefida has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections16

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

40Amostly conserved

56Tvariable

85Cvariable

160Amostly conserved

208Amostly conserved

340Tvariable

400Cvariable

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis buchholzisame genus4.3%Agrotis trifurcasame genus4.3%Agrotis striatasame genus4.4%Sineugraphe exustasame family4.4%Agrotis rileyanasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 124 records

Wild obs. + sensor837

Museum / vouchered287

Range

Area of Occupancy AOO1 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 509≤1 km 114≤10 km 22>10 km 82

727 georeferenced · 110 without coordinates

Open the mapobservation + sensor837

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 3≤1 km 21≤10 km 75>10 km 36

135 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence287

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CUlocation not on record	107
New Haven, US	45
ASUlocation not on record	28
King Saud Universitylocation not on record	21
East Lansing, US	18
US	8
PUC-RSlocation not on record	8
St. Paul, US	7
Albuquerque, US	5
San Diego, US	5
Helsinki, FI	5
Tapachula, MX	4
Brussels, BE	3
Colorado State Universitylocation not on record	3
Awka, NG	2
ZSMlocation not on record	2
National Biodiversity Institute, Costa Ricalocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Ciudad de México, MX	1
US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
RBINS-Scientific Heritagelocation not on record	1
Chicago, US	1

23 institutions · 279 of 287 vouchered records shown · 8 without an institution code

09Environmental DNA16 detections

Where the DNA of Agrotis malefida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 20.5–25.9

Seasonal swing summer↔winter12.9 °C

Max temp (day)28.9 °C 25.9–32.1

Min temp (night)19.7 °C 14.4–22.3

Precipitation99.4 mm/mo 34.3–131

Air humidity59.9 % 57.5–61.2

Moisture balance-69.8 mm/mo -91.1–-31.8

Vapour deficit1,117 Pa 946–1,492

Wind speed3.40 m/s 1.30–4.50

Cloud cover31.5 % 24.0–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis malefida

At a glance

Sources7 archives

At a glance

Record type1 124 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 124 records