Agrotera nemoralis

Scopoli, 1763 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agrotera

At a glance

Occurrence records4 657

Data sources9

Biological traits0

DNA specimens48

eDNA detections64

Sources9 archives

Databases and archives Agrotera nemoralis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 657 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 657 records

Environmental DNA1 datasets · 11 countries64 detections

DNA & barcodingBOLD48 specimens

Genome at a glanceGoaT · NCBI≈523 Mbp

01Narrative

Agrotera nemoralis, the beautiful pearl, is a species of moth of the family Crambidae. It was first described by Giovanni Antonio Scopoli in his 1763 Entomologia Carniolica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotera nemoralis has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes1

eDNA detections64

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

22Gmostly conserved

268Tmostly conserved

361Tmostly conserved

373Gvariable

478Amostly conserved

574Gmostly conserved

616Tmostly conserved

AACTTTATACTTTATTTTTGGGATTTGAGCTGGTATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes12

BINs2

Most divergent pair1.1%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotera discinotatasame genus4.6%Agrotera scissalissame genus6.1%Omiodes poeonalissame family7.4%Lyssa menoetiussame order7.6%Ceromacra tymbersame order7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrotera nemoralis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈522 786 193 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrotera nemoralis0.52 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type4 657 records

Wild obs. + sensor4 099

Museum / vouchered490

Other68

Range

Area of Occupancy AOO9 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 1 452≤1 km 661≤10 km 639>10 km 41

2 793 georeferenced · 1 306 without coordinates

Open the mapobservation + sensor4 099

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 106≤1 km 156≤10 km 121>10 km 8

391 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence490

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	151
Provincia di Livornolocation not on record	70
Zürich, CH	52
Tartu, EE	45
Salzburg, AT	15
SLU Artdatabankenlocation not on record	15
HUNMlocation not on record	14
NHMOlocation not on record	9
Sagamihara, JP	7
European Distributed Institute of Taxonomy (EDIT)location not on record	6
KOMlocation not on record	6
Toyota city nature sanctuarylocation not on record	6
Philadelphia, US	4
South Kensington, GB	4
NSMKlocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	3
DABUHlocation not on record	3
Iwate Prefectural Museumlocation not on record	3
KNAMlocation not on record	3
University of Kaiserslauternlocation not on record	3
YPIMlocation not on record	2
Chiba, JP	2
University of Oulu, Zoological Museumlocation not on record	1
National Institute for Agro-Environmental Scienceslocation not on record	1
RCMlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
MZLUlocation not on record	1
Kawasaki Shi Tama Ku, JP	1
Natural History Museum Rotterdamlocation not on record	1
New Haven, US	1
National Institute of Biological Resourceslocation not on record	1
Helsinki, FI	1
Northwest A&F Universitylocation not on record	1
JP	1
Tallinn, EE	1
ZSMlocation not on record	1
Nijmegen, NL	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1

38 institutions · 442 of 490 vouchered records shown · 48 without an institution code

09Environmental DNA64 detections

Where the DNA of Agrotera nemoralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map11 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 12.6–25.2

Seasonal swing summer↔winter20.0 °C

Max temp (day)21.2 °C 16.5–27.5

Min temp (night)15.0 °C 8.40–23.8

Precipitation105 mm/mo 45.8–218

Air humidity61.2 % 56.3–70.0

Moisture balance-8.20 mm/mo -86.7–58.3

Vapour deficit812 Pa 633–1,156

Wind speed3.10 m/s 1.60–4.20

Cloud cover39.7 % 34.7–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotera nemoralis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 657 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 657 records