Agrostichthys parkeri

(Benham, 1904) · species

image placeholder — illustration coming later

Animalia/Chordata/Lampriformes/Regalecidae/Agrostichthys

At a glance

Occurrence records139

Data sources9

Biological traits4

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Agrostichthys parkeri's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

OBISOcean Biodiversity Information System66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS139 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Agrostichthys parkeri, also called the streamer fish, is a species of oarfish. Only seven identified specimens have been examined, with few found fully intact, and have mainly been found in the Southern Ocean. Agrostichthys parkeri belongs to the Regalecidae (oarfish) family in the Lampriformes order and is the only known member of its genus. This species has been known to grow up to 3 m long and has a ribbon-like body, two large eyes, a protruding mouth and long filamentous rays originating at the head. Due to only seven specimens being found, only the distribution and anatomy of Agrostichthys parkeri can be documented.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length300 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Other traits1

Vulnerability90

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrostichthys parkeri has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

351Cvariable

525Tvariable

CTATACTTAATTTTCGGTGCATGAGCTGGGATAGTCGGAACAGCACTTAGTCTACTCATTCGTGCTGAACTTAGCCAACCCGGAGCCCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trachipterus trachypterussame order16.8%Mastacembelus unicolorsame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor107

Museum / vouchered31

Other1

Range

Area of Occupancy AOO292 km²

Depth

0–200 m sunlit5

200–1000 m twilight39

1–4 km midnight12

>4 km abyssal0

median 644.8 m · max 2 000 m · 56 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 96≤1 km 1≤10 km 2

99 georeferenced · 8 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 2≤1 km 6≤10 km 1

9 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Fish Collectionlocation not on record	6
Zoologisches Museum Hamburglocation not on record	4
FishBaselocation not on record	3
CENPAT-CONICETlocation not on record	1
QVMAGlocation not on record	1

5 institutions · 15 of 31 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Agrostichthys parkeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 9.60–12.8

Seasonal swing summer↔winter6.40 °C

Max temp (day)12.9 °C 10.8–14.4

Min temp (night)10.2 °C 8.20–10.9

Precipitation92.2 mm/mo 85.2–99.4

Air humidity62.1 % 60.9–62.8

Moisture balance33.3 mm/mo

Vapour deficit526 Pa 462–552

Wind speed4.20 m/s

Cloud cover34.4 % 33.5–46.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)