Agromyza vicifoliae

Hering, 1932 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records250

Data sources6

Biological traits0

DNA specimens8

eDNA detections107

Sources6 archives

Databases and archives Agromyza vicifoliae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility250 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF250 records

Environmental DNA3 datasets · 4 countries107 detections

DNA & barcodingBOLD8 specimens

01Narrative

Agromyza vicifoliae is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1932 door Hering.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza vicifoliae has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections107

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.62%

Haplotypes1

BIN1

Where individuals differ — all 9 variable positions, in barcode order

316Gvariable

346Avariable

373Avariable

418Cmostly conserved

451Tvariable

475Gvariable

514Gmostly conserved

544Tvariable

619Cmostly conserved

CACATTATATTTTATATTCGGATCTTGAGCTGGAATAGTGGGGACTTCTTTAAGTATCCTAATTCGAGCCGAACTAGGACATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Fucellia griseolasame order13.8%Agromyza rondensissame genus14.2%Paradelia brunneonigrasame order14.3%Fucellia pictipennissame order14.5%Fucellia ariciiformissame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type250 records

Wild obs. + sensor64

Museum / vouchered186

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 33≤1 km 18≤10 km 8>10 km 1

60 georeferenced · 4 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 19≤1 km 162≤10 km 2

183 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence186

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	177
South Kensington, GB	2
NTNU-VMlocation not on record	1
University of Tokyo, Department of Zoologylocation not on record	1
Tromsø, NO	1
Metsähallituslocation not on record	1

6 institutions · 183 of 186 vouchered records shown · 3 without an institution code

09Environmental DNA107 detections

Where the DNA of Agromyza vicifoliae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys3

Countries4

Verifiable raw sequence linked98

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map4 countries0

Farmland, coast and birch habitatHay meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 12.0–15.8

Seasonal swing summer↔winter19.8 °C

Max temp (day)17.9 °C 15.7–19.5

Min temp (night)9.20 °C 8.00–11.6

Precipitation76.5 mm/mo 57.3–99.9

Air humidity58.8 % 55.7–60.6

Moisture balance-35.5 mm/mo -55.2–-13.7

Vapour deficit673 Pa 590–734

Wind speed2.70 m/s 2.40–3.70

Cloud cover49.5 % 41.7–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)