Agromyza reptans

Fallén, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records193

Data sources7

Biological traits0

DNA specimens11

eDNA detections366

Sources7 archives

Databases and archives Agromyza reptans's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI366 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF193 records

Environmental DNA4 datasets · 8 countries366 detections

DNA & barcodingBOLD11 specimens

01Narrative

Agromyza reptans is a species of leaf miner flies in the family Agromyzidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza reptans has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections366

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

79Amostly conserved

205Amostly conserved

220Amostly conserved

271Gvariable

343Avariable

364Cmostly conserved

373Gvariable

400Gmostly conserved

457Tmostly conserved

496Gmostly conserved

589Cmostly conserved

601Cmostly conserved

625Amostly conserved

631Gmostly conserved

654Tmostly conserved

AACTCTATATTTTATATTTGGGGCATGGGCTGGTATAGTAGGTACTTCTTTAAGTATTTTAATCCGAGCTGAACTAGGACACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes4

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aulagromyza hendelianasame family12.6%Sphyracephala subbifasciatasame order12.8%Phytomyza horticolasame family13.0%Phytomyza syngenesiaesame family13.2%Phytomyza davisiisame family13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type193 records

Wild obs. + sensor162

Museum / vouchered31

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 70≤1 km 24≤10 km 64

158 georeferenced · 4 without coordinates

Open the mapobservation + sensor162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 8≤1 km 6≤10 km 6>10 km 1

21 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CBDClocation not on record	5
South Kensington, GB	5
SGAV-and-NHMDlocation not on record	4
Naturalis Biodiversity Centerlocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	2
Stockholm, SE	1
Helsinki, FI	1
Washington, US	1
NCMGlocation not on record	1
V. N. Karazin Kharkiv National Universitylocation not on record	1

10 institutions · 23 of 31 vouchered records shown · 8 without an institution code

09Environmental DNA366 detections

Where the DNA of Agromyza reptans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found366

Studies independent surveys4

Countries8

Verifiable raw sequence linked306

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 366 detections have coordinates

Open the map8 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 11.5–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)19.4 °C 15.1–21.2

Min temp (night)12.8 °C 8.60–13.7

Precipitation71.1 mm/mo 53.6–84.6

Air humidity60.7 % 58.3–63.0

Moisture balance-37.6 mm/mo -61.2–-8.90

Vapour deficit700 Pa 540–798

Wind speed3.70 m/s 2.50–4.30

Cloud cover47.1 % 39.8–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 366 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)