Agromyza pseudoreptans

Nowakowski, 1964 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records488

Data sources7

Biological traits0

DNA specimens55

eDNA detections278

Sources7 archives

Databases and archives Agromyza pseudoreptans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI278 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF488 records

Environmental DNA4 datasets · 10 countries278 detections

DNA & barcodingBOLD55 specimens

01Narrative

Agromyza pseudoreptans is a species of leaf miner flies in the family Agromyzidae. It has been known to feed on Urtica dioica and Urtica pilulifera both of which are nettles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza pseudoreptans has left across the world's sequence archives.

At a glance

DNA specimens55

BINs3

Marker genes1

eDNA detections278

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

23Tmostly conserved

29Amostly conserved

32Amostly conserved

68Cmostly conserved

71Gmostly conserved

74Tmostly conserved

77Gmostly conserved

86Tmostly conserved

89Cmostly conserved

116Cmostly conserved

125Amostly conserved

161Amostly conserved

167Cmostly conserved

170Cmostly conserved

200Cmostly conserved

203Cmostly conserved

210Tmostly conserved

218Tmostly conserved

221Tmostly conserved

248Cmostly conserved

263Gmostly conserved

266Cmostly conserved

269Cmostly conserved

272Amostly conserved

275Amostly conserved

276Cmostly conserved

278Tmostly conserved

281Tmostly conserved

285Tmostly conserved

287Gmostly conserved

288Tmostly conserved

290Amostly conserved

296Tmostly conserved

299Tmostly conserved

300Tmostly conserved

305Gmostly conserved

314Amostly conserved

320Gmostly conserved

326Amostly conserved

332Cmostly conserved

344Gmostly conserved

345Tmostly conserved

347Amostly conserved

356Tmostly conserved

374Tmostly conserved

377Tmostly conserved

383Cmostly conserved

384Cmostly conserved

398Tmostly conserved

401Tmostly conserved

410Amostly conserved

413Amostly conserved

434Cmostly conserved

437Tmostly conserved

455Amostly conserved

458Cmostly conserved

467Amostly conserved

476Gmostly conserved

494Amostly conserved

497Tmostly conserved

512Tmostly conserved

515Gmostly conserved

524Amostly conserved

527Amostly conserved

534Tmostly conserved

536Amostly conserved

537Tmostly conserved

539Amostly conserved

542Amostly conserved

554Amostly conserved

555Cmostly conserved

557Tmostly conserved

560Amostly conserved

572Amostly conserved

608Cmostly conserved

617Tmostly conserved

620Gmostly conserved

623Gvariable

CTTTATATTTTATATTTGGAGCTTGAGCAGGAATAGTAGGTACTTCTTTAAGAATTTTAATCCGAGCCGAGCTTGGGCACCCTGGTGCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes15

BINs3

Most divergent pair16.3%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agromyza cinerascenssame genus13.0%Calycomyza solidaginissame family13.3%Myopina crassipalpissame order13.3%Geomyza luridasame order13.4%Geomyza vespertinasame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type488 records

Wild obs. + sensor428

Museum / vouchered60

Range

Area of Occupancy AOO1 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 225≤1 km 91≤10 km 79

395 georeferenced · 33 without coordinates

Open the mapobservation + sensor428

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 28≤1 km 9≤10 km 5

42 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Tokyo, Department of Zoologylocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
NHMOlocation not on record	4
Helsinki, FI	3
Tilburg, NL	2
DFFW1981location not on record	1
DFFW2016location not on record	1
Metsähallituslocation not on record	1
NTNU-VMlocation not on record	1
NCMGlocation not on record	1
SLU Artdatabankenlocation not on record	1

11 institutions · 26 of 60 vouchered records shown · 34 without an institution code

09Environmental DNA278 detections

Where the DNA of Agromyza pseudoreptans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found278

Studies independent surveys4

Countries10

Verifiable raw sequence linked168

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 278 detections have coordinates

Open the map10 countries0

1. Forest & Woodland|1.1. Boreal ForestForest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.6–15.8

Seasonal swing summer↔winter17.8 °C

Max temp (day)17.7 °C 12.9–19.8

Min temp (night)10.4 °C 6.40–12.4

Precipitation69.3 mm/mo 51.0–92.1

Air humidity60.2 % 57.3–62.9

Moisture balance-42.7 mm/mo -66.7–-0.6

Vapour deficit647 Pa 486–723

Wind speed3.60 m/s 2.30–5.20

Cloud cover47.5 % 39.0–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 277 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)