Agromyza idaeiana

Hardy, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records492

Data sources6

Biological traits0

DNA specimens26

eDNA detections97

Sources6 archives

Databases and archives Agromyza idaeiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility492 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF492 records

Environmental DNA3 datasets · 6 countries97 detections

DNA & barcodingBOLD26 specimens

01Narrative

Agromyza idaeiana is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam werd gepubliceerd in 1853 door Hardy.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza idaeiana has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections97

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

73Tmostly conserved

78Gvariable

87Gvariable

183Gvariable

267Tvariable

270Cvariable

312Cvariable

315Avariable

321Amostly conserved

327Amostly conserved

363Tmostly conserved

372Avariable

381Tmostly conserved

447Cmostly conserved

465Gvariable

603Cmostly conserved

ACATTGTATTTTATATTTGGTGCATGAGCCGGAATGGTTGGAACTTCTTTAAGTATTTTAATTCGAGCTGAATTAGGGCACCCTGGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes7

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phytobia setosasame family14.3%Pullimosina pullulasame order14.4%Suillia humilissame order14.7%Oreothalia pelopssame order14.8%Drosophila obscurasame order14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type492 records

Wild obs. + sensor408

Museum / vouchered84

Range

Area of Occupancy AOO1 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 195≤1 km 99≤10 km 80>10 km 2

376 georeferenced · 32 without coordinates

Open the mapobservation + sensor408

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 4≤1 km 27≤10 km 48>10 km 3

82 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	70
NHMOlocation not on record	5
South Kensington, GB	2
Helsinki, FI	1
DFFW2016location not on record	1
University of Tokyo, Department of Zoologylocation not on record	1
Tilburg, NL	1

7 institutions · 81 of 84 vouchered records shown · 3 without an institution code

09Environmental DNA97 detections

Where the DNA of Agromyza idaeiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys3

Countries6

Verifiable raw sequence linked71

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map6 countries0

1.1. Boreal Forest|1. Forest & Woodland14. Artificial - Terrestrial | 14.5 Urban Ar…Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 8.40–16.1

Seasonal swing summer↔winter16.9 °C

Max temp (day)15.2 °C 9.70–19.0

Min temp (night)9.10 °C 6.20–13.0

Precipitation59.5 mm/mo 38.0–110

Air humidity60.6 % 57.9–63.6

Moisture balance-41.6 mm/mo -87.0–33.5

Vapour deficit591 Pa 438–705

Wind speed3.90 m/s 2.20–5.30

Cloud cover45.3 % 39.6–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 97 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)