Agromyza fragariae

Malloch, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records12

Data sources5

Biological traits0

DNA specimens9

eDNA detections11

Sources5 archives

Databases and archives Agromyza fragariae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

Environmental DNA2 datasets · 2 countries11 detections

DNA & barcodingBOLD9 specimens

01Narrative

Agromyza fragariae is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1913 door Malloch.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza fragariae has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

21Amostly conserved

30Tvariable

39Amostly conserved

66Gvariable

81Cmostly conserved

87Gmostly conserved

90Amostly conserved

120Amostly conserved

201Cvariable

216Gmostly conserved

219Tmostly conserved

270Cvariable

381Cmostly conserved

414Amostly conserved

507Gvariable

537Gmostly conserved

540Amostly conserved

594Cvariable

600Tmostly conserved

615Cmostly conserved

621Tmostly conserved

633Cvariable

645Cmostly conserved

648Avariable

ACATTATATTTTATGTTTGGAGCATGGGCTGGAATAGTAGGGACTTCTTTAAGTATCCTAATCCGGGCAGAATTAGGCCACCCTGGGGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rachispoda vespertinasame order13.3%Howickia myrmecophilasame order14.5%Megaselia elenaesame order14.8%Cerodontha geniculatasame family14.8%Agromyza cinerascenssame genus14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type12 records

Museum / vouchered12

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Washington, US	1

2 institutions · 6 of 12 vouchered records shown · 6 without an institution code

09Environmental DNA11 detections

Where the DNA of Agromyza fragariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys2

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Forest4. Native Grassland | 4.1. Tundra1. Forest & Woodland | 1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 5.80–13.6

Seasonal swing summer↔winter33.5 °C

Max temp (day)14.2 °C 10.0–18.2

Min temp (night)6.20 °C 2.20–8.20

Precipitation53.5 mm/mo 52.2–87.9

Air humidity55.7 % 52.5–64.0

Moisture balance-36.7 mm/mo -72.6–-11.8

Vapour deficit510 Pa 335–757

Wind speed3.00 m/s 1.90–3.70

Cloud cover48.3 % 40.5–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)