Agromyza erythrocephala

Hendel, 1920 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records10

Data sources6

Biological traits0

DNA specimens3

eDNA detections34

Sources6 archives

Databases and archives Agromyza erythrocephala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

Environmental DNA3 datasets · 3 countries34 detections

DNA & barcodingBOLD3 specimens

01Narrative

De wikkemineervlieg is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1920 door Hendel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza erythrocephala has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections34

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

GTTGTATTTTGTATTTGGGTCTTGAGCCGGAATAGTCGGAACTTCTTTAAGTATTTTAATTCGGGCCGAATTAGGCCACCCAGGAGCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azelia nebulosasame order13.0%Cholomyia inaequipessame order13.4%Drosophila birchiisame order14.5%Cosmetopus longussame order14.5%Oedalea freyisame order14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor7

Museum / vouchered3

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 4≤10 km 3

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NTNU-VMlocation not on record	1

1 institutions · 1 of 3 vouchered records shown · 2 without an institution code

09Environmental DNA34 detections

Where the DNA of Agromyza erythrocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys3

Countries3

Verifiable raw sequence linked31

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map3 countries0

Farmland, coast and birch habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 11.0–14.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)15.7 °C 15.7–17.8

Min temp (night)6.40 °C 6.40–10.8

Precipitation49.2 mm/mo 49.2–84.9

Air humidity56.3 % 56.3–59.5

Moisture balance-46.8 mm/mo -46.8–-28.3

Vapour deficit573 Pa 573–693

Wind speed2.60 m/s 2.20–3.30

Cloud cover47.8 % 47.6–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)