Agromyza anthracina

Meigen, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Agromyza

At a glance

Occurrence records628

Data sources6

Biological traits0

DNA specimens25

eDNA detections393

Sources6 archives

Databases and archives Agromyza anthracina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI393 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF628 records

Environmental DNA4 datasets · 7 countries393 detections

DNA & barcodingBOLD25 specimens

01Narrative

Agromyza anthracina is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1830 door Meigen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agromyza anthracina has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections393

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

31Tmostly conserved

67Amostly conserved

268Amostly conserved

302Tmostly conserved

313Tvariable

328Gmostly conserved

373Gmostly conserved

412Cvariable

536Tmostly conserved

562Amostly conserved

565Gmostly conserved

604Cmostly conserved

622Amostly conserved

AACTCTATATTTTATATTTGGGGCATGGGCTGGGATAGTCGGAACTTCTTTAAGAATTTTAATTCGAGCAGAGCTTGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes4

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calycomyza majusculasame family13.2%Pollenia tenuiforcepssame order13.7%Pseudocollinella parasciaspidissame order13.9%Pollenia similissame order14.0%Spelobia nanasame order14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type628 records

Wild obs. + sensor605

Museum / vouchered23

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 241≤1 km 77≤10 km 240

558 georeferenced · 47 without coordinates

Open the mapobservation + sensor605

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 9≤10 km 3>10 km 1

18 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	6
NTNU-VMlocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	2
South Kensington, GB	2
Stockholm, SE	1
Wellcome Sanger Institutelocation not on record	1
SGAV-and-NHMDlocation not on record	1
NHMOlocation not on record	1
Tilburg, NL	1

9 institutions · 17 of 23 vouchered records shown · 6 without an institution code

09Environmental DNA393 detections

Where the DNA of Agromyza anthracina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found393

Studies independent surveys4

Countries7

Verifiable raw sequence linked333

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 393 detections have coordinates

Open the map7 countries0

1. Forest & Woodland|1.4. Temperate ForestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 10.9–16.8

Seasonal swing summer↔winter18.3 °C

Max temp (day)17.5 °C 13.5–20.2

Min temp (night)10.5 °C 6.40–13.4

Precipitation67.4 mm/mo 48.6–84.9

Air humidity60.5 % 57.8–63.9

Moisture balance-35.8 mm/mo -58.5–11.2

Vapour deficit610 Pa 487–724

Wind speed3.80 m/s 2.50–4.50

Cloud cover47.8 % 38.8–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 393 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)