Agrocybe rivulosa

Nauta · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Agrocybe

At a glance

Occurrence records1 360

Data sources9

Biological traits0

DNA specimens7

eDNA detections5

Sources9 archives

Databases and archives Agrocybe rivulosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 360 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Agrocybe rivulosa is a species of mushroom in the genus Agrocybe. The first recorded sighting of the mushroom was in 2003. The species was first found in Britain in the year 2004. It is a relatively large mushroom, with a stem of 5 to 10 centimeters, and a cap which reaches 4 to 10 centimeters across. The colour of the cap ranges from yellow to pale orange-brown. It has been eaten, and is reasonably tasty with no obvious toxicity.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrocybe rivulosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences6

eDNA detections5

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP474663.1 ↗396 bpIndia

ACGT

AATGGGCCTTGTGCCTATAAAAAGTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATA …

Agrocybe rivulosa voucher CUHAM 954 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS1

fungal barcode

08Occurrence & distribution

Record type1 360 records

Wild obs. + sensor1 304

Museum / vouchered56

Range

Area of Occupancy AOO3 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 242≤1 km 67≤10 km 866>10 km 14

1 189 georeferenced · 115 without coordinates

Open the mapobservation + sensor1 304

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 8≤1 km 2≤10 km 13

23 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	13
TENN-Flocation not on record	4
Olocation not on record	4
Copenhagen, DK	4
CJBGlocation not on record	3
University of Oslo, Natural History Museumlocation not on record	3
Tilburg, NL	3
San Sebastián, ES	2
Helsinki, FI	1
Karlsruhe, DE	1

10 institutions · 38 of 56 vouchered records shown · 17 without an institution code

09Environmental DNA5 detections

Where the DNA of Agrocybe rivulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

GjÃ¸dselhaug

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 10.9–12.4

Seasonal swing summer↔winter21.6 °C

Max temp (day)15.1 °C 14.0–17.5

Min temp (night)7.90 °C 6.90–8.90

Precipitation86.7 mm/mo 63.4–106

Air humidity60.0 % 57.2–62.8

Moisture balance6.00 mm/mo -41.5–57.6

Vapour deficit557 Pa 493–688

Wind speed2.90 m/s 2.00–5.00

Cloud cover42.1 % 38.0–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrocybe rivulosa

At a glance

Sources9 archives

At a glance

Record type1 360 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 360 records