Agrocybe retigera

(Speg.) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Agrocybe

At a glance

Occurrence records256

Data sources8

Biological traits0

DNA specimens1

eDNA detections122

Sources8 archives

Databases and archives Agrocybe retigera's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility256 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI122 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF256 records

Environmental DNA4 datasets · 3 countries122 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Agrocybe retigera is a species of mushroom in the genus Agrocybe. The first known sighting of the species was in the early 1950s. It was first described by author Speggazini Singer in 1950. The mushroom has since been found in common areas, especially grassy ones, such as gardens, meadows and parks. Agrocybe retigera is most commonly found in tropical and sub-tropical areas around the globe. The size of the cap is usually between 17 and 44 millimetres, and it is generally pale in colour. The colour of the mushroom itself ranges from cream to pale-brown.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrocybe retigera has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections122

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ533332.1 ↗392 bpIndia · 2023

ACGT

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCC …

Agrocybe retigera isolate Anai_SF44 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type256 records

Wild obs. + sensor194

Museum / vouchered62

Origin

Native1

Range

Area of Occupancy AOO768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 103≤1 km 19≤10 km 12>10 km 9

143 georeferenced · 51 without coordinates

Open the mapobservation + sensor194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 13≤1 km 2≤10 km 1>10 km 4

20 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	21
Mexico City, MX	9
Departamento de Sistematica e Ecologialocation not on record	5
UFSClocation not on record	4
TENN-Flocation not on record	3
Philadelphia, US	3
UFAClocation not on record	2
UFPElocation not on record	2
Durango, MX	2
Tampa, US	1
Personal Herbarium of Robert Bensonlocation not on record	1
IPA/SPlocation not on record	1
ILLSlocation not on record	1
FLASlocation not on record	1
Universidad del Magdalena (UniMagdalena)location not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

16 institutions · 58 of 62 vouchered records shown · 4 without an institution code

09Environmental DNA122 detections

Where the DNA of Agrocybe retigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found122

Studies independent surveys4

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 122 detections have coordinates

Open the map3 countries0

Turf

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature23.0 °C 14.5–27.0

pH6.32 4.40–8.80

Conductivity108 µS/cm 23.0–54,500

Organic carbon0.77 % 0.11–3.90

Water content10.4 % 0.815–18.9

Nitrate-N8.00 mg/kg 1.00–470

Phosphorus19.0 mg/kg 2.00–189

Clay14.7 % 5.08–42.2

Sand71.2 % 36.3–91.0

Depth0 m 0–0.2

SoilMarineHydrosolVertosolCalcarosolVertosolsTenosolKandosol

39 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 11.8–27.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)27.8 °C 17.8–30.5

Min temp (night)18.2 °C 6.80–24.8

Precipitation29.3 mm/mo 5.80–342

Air humidity55.4 % 47.8–66.6

Moisture balance-41.5 mm/mo -133–172

Vapour deficit1,203 Pa 614–1,554

Wind speed3.30 m/s 1.70–4.40

Cloud cover23.1 % 17.4–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 122 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)