Agrocybe acericola

(Peck) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Agrocybe

At a glance

Occurrence records406

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Agrocybe acericola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility406 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF406 records

DNA & barcodingNCBIsequences

01Narrative

Agrocybe acericola, l'Agrocybe de l'érable, est une espèce de champignons basidiomycètes de la famille des Strophariaceae. Agrocybe acericola est une espèce nord-américaine qui pousse dans les forêts de feuillus des Grandes Plaines et plus à l'est, à la fin du printemps et au début de l'été. Il se distingue des autres Agrocybes par cette écologie ainsi que par sa couleur jaune brunâtre, son anneau blanc positionné très haut qui s'évase initialement vers le haut et l'extérieur puis s'affaisse.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrocybe acericola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX375185.1 ↗692 bpUSA · 2024

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACTGGCGTGGTTGTAGCTGGCCCCTCGGGGGCATGTGC …

Agrocybe acericola isolate OMDL iNat # 226505994 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type406 records

Wild obs. + sensor251

Museum / vouchered155

Range

Area of Occupancy AOO1 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 68≤1 km 20≤10 km 27>10 km 24

139 georeferenced · 112 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 15≤1 km 17≤10 km 34>10 km 5

71 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	34
Université de Montréal Biodiversity Centrelocation not on record	21
Chicago, US	15
Ann Arbor, US	14
TENN-Flocation not on record	14
Davis and Elkins Collegelocation not on record	9
Denver, US	8
ILLSlocation not on record	8
WTUlocation not on record	6
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Pullman, US	3
Vancouver, CA	3
St. Paul, US	3
Acadia Universitylocation not on record	2
CA	2
Blacksburg, US	2
Chapel Hill, US	1
Toronto, CA	1
Santa Cruz, US	1
McWane Science Centerlocation not on record	1

20 institutions · 152 of 155 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)