Agrochola lunosa

Haworth, 1809 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrochola

At a glance

Occurrence records21 393

Data sources5

Biological traits0

DNA specimens22

eDNA detections39

Sources5 archives

Databases and archives Agrochola lunosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 393 records

Environmental DNA1 datasets · 7 countries39 detections

DNA & barcodingBOLD22 specimens

01Narrative

Agrochola postmarginata là một loài bướm đêm trong họ Noctuidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrochola lunosa has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections39

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

34Gvariable

103Tvariable

616Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGGATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes6

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Conistra aliciasame family5.2%Conistra ragusaesame family5.3%Stenopterygia firmivenasame family5.5%Stenopterygia subcurvasame family5.6%Conistra ianasame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type21 393 records

Wild obs. + sensor20 665

Museum / vouchered182

Other546

Origin

Native51

Range

Area of Occupancy AOO13 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 6 082≤1 km 1 426≤10 km 10 279>10 km 182

17 969 georeferenced · 2 696 without coordinates

Open the mapobservation + sensor20 665

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 20≤10 km 27

48 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	82
Natural History Museum Rotterdamlocation not on record	44
Nijmegen, NL	39
ZSMlocation not on record	2
NHMOlocation not on record	2
Brussels, BE	2
Tartu, EE	1

7 institutions · 172 of 182 vouchered records shown · 10 without an institution code

09Environmental DNA39 detections

Where the DNA of Agrochola lunosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 10.7–16.7

Seasonal swing summer↔winter15.4 °C

Max temp (day)16.9 °C 13.9–21.4

Min temp (night)9.60 °C 6.80–12.5

Precipitation73.3 mm/mo 50.9–106

Air humidity62.5 % 59.2–64.0

Moisture balance-1.00 mm/mo -36.1–43.4

Vapour deficit583 Pa 481–768

Wind speed3.50 m/s 2.90–4.90

Cloud cover43.2 % 39.3–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrochola lunosa

At a glance

Sources5 archives

At a glance

Record type21 393 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 393 records