Agrochola laevis

Hübner, 1803 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrochola

At a glance

Occurrence records949

Data sources5

Biological traits0

DNA specimens19

eDNA detections34

Sources5 archives

Databases and archives Agrochola laevis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility949 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF949 records

Environmental DNA1 datasets · 5 countries34 detections

DNA & barcodingBOLD19 specimens

01Narrative

Agrochola laevis is a moth of the family Noctuidae. It was described by Jacob Hübner in 1803. It has a disjunct distribution in southern and central Europe, the Near East, Asia Minor and Armenia. The habitat consists of warm deciduous forests. The wingspan is 32–37 mm. Adults are on wing from August to October in one generation per year. The larvae feed on Vaccinium myrtillus, Salix caprea, Stellaria media, Lamium, Quercus, Rumex and Ulmus species."Agrochola laevis (Hübner, [1800-1803])". Euroleps.ch.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrochola laevis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections34

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

49Gmostly conserved

85Tmostly conserved

220Tmostly conserved

302Amostly conserved

346Tmostly conserved

370Avariable

433Amostly conserved

470Tmostly conserved

514Gvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCGTTAAGATTACTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes4

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lithophane baileyisame family5.9%Mesogona oxalinasame family5.9%Eupsilia transversasame family6.1%Lithophane dispositasame family6.1%Lithophane patefactasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type949 records

Wild obs. + sensor459

Museum / vouchered303

Other187

Origin

Native108

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 126≤1 km 135≤10 km 162>10 km 6

429 georeferenced · 30 without coordinates

Open the mapobservation + sensor459

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 9≤1 km 146≤10 km 125>10 km 4

284 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	147
SFRAlocation not on record	37
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	11
Zürich, CH	10
Geneva, CH	8
Muzeum Górnośląskie w Bytomiulocation not on record	8
Dhaka, BD	5
DanishLepidopterologicalSocietylocation not on record	4
DABUHlocation not on record	3
Bern, CH	2
МПХУlocation not on record	2
ZSMlocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
ННПМ НАНУlocation not on record	1
Philadelphia, US	1
Tartu, EE	1
John May Museum of Natural Historylocation not on record	1
ЗИН РАНlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

20 institutions · 246 of 303 vouchered records shown · 57 without an institution code

09Environmental DNA34 detections

Where the DNA of Agrochola laevis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map5 countries0

mixed forestheathlandjuniperus forestdry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 10.3–16.6

Seasonal swing summer↔winter15.5 °C

Max temp (day)16.9 °C 14.7–21.4

Min temp (night)9.60 °C 6.60–12.5

Precipitation74.3 mm/mo 50.9–104

Air humidity63.2 % 59.4–63.8

Moisture balance22.1 mm/mo -28.9–38.8

Vapour deficit540 Pa 469–768

Wind speed3.10 m/s 2.40–3.70

Cloud cover43.2 % 40.3–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)