Agriphila vulgivagellus

Clemens, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records4 555

Data sources7

Biological traits0

DNA specimens106

eDNA detections106

Sources7 archives

Databases and archives Agriphila vulgivagellus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 555 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI106 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics106 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 555 records

Environmental DNA1 datasets · 2 countries106 detections

DNA & barcodingBOLD106 specimens

01Narrative

Agriphila vulgivagellus, the vagabond crambus or vagabond sod webworm, is a moth of the family Crambidae. It is found from Quebec and New England to Florida, west to Texas and north to Alberta. The wingspan is 20–39 mm. Adults are on wing from August to October in one generation per year. The larvae feed on various grasses, as well as wheat, rye and other grains. Immature larvae overwinter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding106 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila vulgivagellus has left across the world's sequence archives.

At a glance

DNA specimens106

BINs2

Marker genes1

eDNA detections106

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus103 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

37Gmostly conserved

64Tvariable

91Tmostly conserved

172Tmostly conserved

193Cmostly conserved

271Gmostly conserved

289Gmostly conserved

307Avariable

364Tmostly conserved

379Cmostly conserved

391Tmostly conserved

397Cmostly conserved

400Avariable

451Cmostly conserved

530Cmostly conserved

541Tmostly conserved

550Amostly conserved

583Tmostly conserved

613Cmostly conserved

628Amostly conserved

634Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACATCATTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes24

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila undatussame genus5.0%Agriphila biothanatalissame genus5.3%Agriphila dalmatinellussame genus7.4%Catoptria combinellasame family7.9%Agriphila geniculeasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 555 records

Wild obs. + sensor3 848

Museum / vouchered707

Range

Area of Occupancy AOO8 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2 232≤1 km 444≤10 km 115>10 km 361

3 152 georeferenced · 696 without coordinates

Open the mapobservation + sensor3 848

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 33≤1 km 55≤10 km 289>10 km 31

408 georeferenced · 299 without coordinates

Open the institutions mapphysical evidence707

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	181
New Haven, US	123
University of Alberta Museums (UAM)location not on record	64
Mississippi State, US	48
University of Guelph, Centre for Biodiversity Genomicslocation not on record	36
San Francisco, US	29
St. Paul, US	22
Washington, US	18
Royal Saskatchewan Museumlocation not on record	18
Cornell University Insect Collectionlocation not on record	17
Cleveland Museum of Natural History, OH (CLEV)location not on record	17
CUlocation not on record	15
Vernal, US	14
Philadelphia, US	11
Georgia Museum of Natural Historylocation not on record	8
Denver, US	6
SOVTlocation not on record	4
ASUlocation not on record	4
Blacksburg, US	3
Albuquerque, US	2
Cambridge, US	2
Decorah, US	2
Universidad Católica de Manizaleslocation not on record	2
Natural History Museum of Utahlocation not on record	1
University of Guelphlocation not on record	1
OSUClocation not on record	1
Saint John, CA	1

27 institutions · 650 of 707 vouchered records shown · 57 without an institution code

09Environmental DNA106 detections

Where the DNA of Agriphila vulgivagellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found106

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 106 detections have coordinates

Open the map2 countries0

Grassland4. Native GrasslandMixed HabitatTemperate mixed forestRiparian Zone1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 11.8–20.7

Seasonal swing summer↔winter26.9 °C

Max temp (day)20.8 °C 16.8–28.0

Min temp (night)13.9 °C 7.70–18.4

Precipitation102 mm/mo 69.0–114

Air humidity60.0 % 55.2–64.0

Moisture balance-3.50 mm/mo -65.1–47.8

Vapour deficit754 Pa 539–1,178

Wind speed3.00 m/s 2.40–5.00

Cloud cover47.6 % 33.8–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 100 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriphila vulgivagellus

At a glance

Sources7 archives

At a glance

Record type4 555 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 555 records