Agriphila inquinatella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agriphila

At a glance

Occurrence records35 508

Data sources9

Biological traits0

DNA specimens122

eDNA detections148

Sources9 archives

Databases and archives Agriphila inquinatella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 508 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI148 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 508 records

Environmental DNA3 datasets · 12 countries148 detections

DNA & barcodingBOLD122 specimens

Genome at a glanceGoaT · NCBI≈795 Mbp

01Narrative

The name Agriphila inquinatella has been misapplied to some related species in the past; see below for details. Agriphila inquinatella is a small moth species of the family Crambidae. It is found in Europe, around the Caucasus area to Turkestan, and in the Near East to Jordan. Three subspecies are accepted today: Agriphila inquinatella inquinatella (Denis & Schiffermüller, 1775) – most of the range Agriphila inquinatella nevadensis (Caradja, 1910) – Sierra Nevada and presumably elsewhere in Spain Agriphila inquinatella elbursella (Zerny, 1939) – Alborz mountains and presumably elsewhere in the Caucasus region The adult moths fly between June to September, depending on the location. Their wingspan is 23–29 mm. The caterpillars feed mainly on Poaceae grasses, such as meadow-grass species (Poa) or sheep's fescue (Festuca ovina). They can be found under pebbles adjacent to their food plants, suggesting that they feed on the plants' roots. A more unusual food plant is the Pottiales moss Tortula muralis.Grabe (1942), and see references in Savela (2005)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriphila inquinatella has left across the world's sequence archives.

At a glance

DNA specimens122

BINs1

Marker genes1

eDNA detections148

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus117 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

16Cmostly conserved

31Gvariable

58Gvariable

100Gvariable

106Tmostly conserved

217Gmostly conserved

271Cmostly conserved

364Cmostly conserved

428Tvariable

586Cvariable

601Cvariable

616Tvariable

AACATTATACTTTATCTTTGGAATTTGAGCGGGAATAGTAGGAACTTCATTAAGATTGTTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes14

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriphila dalmatinellussame genus6.1%Agriphila tollisame genus6.2%Agriphila geniculeasame genus6.2%Agriphila brioniellussame genus6.5%Agriphila cyrenaicellussame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agriphila inquinatella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈794 588 780 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agriphila inquinatella0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type35 508 records

Wild obs. + sensor32 551

Museum / vouchered2 832

Other125

Origin

Native3

Range

Area of Occupancy AOO34 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 14 975≤1 km 6 198≤10 km 7 538>10 km 258

28 969 georeferenced · 3 582 without coordinates

Open the mapobservation + sensor32 551

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 519≤1 km 1 018≤10 km 725>10 km 341

2 603 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence2 832

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 399
DanishLepidopterologicalSocietylocation not on record	273
NHMOlocation not on record	156
Provincia di Livornolocation not on record	143
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	100
NTNU-VMlocation not on record	94
Philadelphia, US	92
Tartu, EE	74
Zürich, CH	55
SLU Artdatabankenlocation not on record	49
Kuopio, FI	28
Salzburg, AT	26
Nijmegen, NL	24
Stockholm, SE	23
Natural History Museum Rotterdamlocation not on record	21
Adam Mickiewicz University in Poznańlocation not on record	20
DABUHlocation not on record	14
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	14
Tromsø, NO	10
Tallinn, EE	10
Rovaniemi, FI	8
South Kensington, GB	7
ZMAAlocation not on record	7
MZLUlocation not on record	5
BioFokuslocation not on record	4
Natural History Museum, Londonlocation not on record	4
CBDClocation not on record	3
neflocation not on record	3
Metsähallituslocation not on record	3
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	3
NMBU:MINAlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
University of Kaiserslauternlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
ZAF-UMUlocation not on record	1

35 institutions · 2 678 of 2 832 vouchered records shown · 154 without an institution code

09Environmental DNA148 detections

Where the DNA of Agriphila inquinatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found148

Studies independent surveys3

Countries12

Verifiable raw sequence linked28

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 148 detections have coordinates

Open the map12 countries0

edge forestforestmeadowswoodlanddry grasslandprivate garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 12.4–20.0

Seasonal swing summer↔winter19.1 °C

Max temp (day)21.1 °C 16.5–24.6

Min temp (night)12.6 °C 7.80–15.2

Precipitation78.7 mm/mo 47.8–124

Air humidity59.8 % 57.1–63.0

Moisture balance-27.9 mm/mo -73.9–47.8

Vapour deficit792 Pa 559–995

Wind speed2.70 m/s 2.00–4.10

Cloud cover37.7 % 34.2–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 145 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriphila inquinatella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type35 508 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type35 508 records