Agriopis bajaria

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Agriopis

At a glance

Occurrence records2 029

Data sources6

Biological traits0

DNA specimens69

eDNA detections45

Sources6 archives

Databases and archives Agriopis bajaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 029 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 029 records

Environmental DNA1 datasets · 14 countries45 detections

DNA & barcodingBOLD69 specimens

01Narrative

Agriopis bajaria is een vlinder uit de familie spanners (Geometridae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1775 door Denis & Schiffermüller. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriopis bajaria has left across the world's sequence archives.

At a glance

DNA specimens69

BINs6

Marker genes3

eDNA detections45

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

55Amostly conserved

61Tmostly conserved

64Gmostly conserved

79Tvariable

82Amostly conserved

97Avariable

127Tmostly conserved

130Gvariable

157Amostly conserved

160Amostly conserved

178Amostly conserved

184Tmostly conserved

187Amostly conserved

209Tmostly conserved

214Gmostly conserved

217Cmostly conserved

235Cmostly conserved

244Cmostly conserved

259Amostly conserved

260Tmostly conserved

263Tmostly conserved

265Gvariable

283Tmostly conserved

325Gvariable

334Cmostly conserved

340Cmostly conserved

343Tvariable

344Tmostly conserved

358Tmostly conserved

361Gmostly conserved

364Cmostly conserved

367Amostly conserved

385Amostly conserved

397Cmostly conserved

400Gvariable

415Tmostly conserved

430Amostly conserved

496Cvariable

497Tmostly conserved

514Amostly conserved

544Amostly conserved

553Gvariable

554Tmostly conserved

559Avariable

562Amostly conserved

571Cmostly conserved

586Cmostly conserved

593Tmostly conserved

598Tvariable

613Cvariable

622Amostly conserved

625Amostly conserved

643Cmostly conserved

ATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCACTAAGATTATTAATTCGGGCAGAATTAGGTAATCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes16

BINs6

Most divergent pair6.1%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dinophalus thrasyschemasame family7.5%Parapheromia lichenariasame family8.0%Pseudeusemia flavoplagatasame family8.1%Psilalcis isombrasame family8.3%Paleacrita vernatasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCADEF1-alpha

animal barcodemarker

08Occurrence & distribution

Record type2 029 records

Wild obs. + sensor1 339

Museum / vouchered659

Other31

Origin

Native272

Range

Area of Occupancy AOO2 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 409≤1 km 162≤10 km 235>10 km 25

831 georeferenced · 508 without coordinates

Open the mapobservation + sensor1 339

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤1 km 74≤10 km 511>10 km 13

599 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence659

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	201
Bern, CH	50
Geneva, CH	44
Dhaka, BD	43
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	34
Salzburg, AT	33
Archäologie und Museum Baselland - Museum.BLlocation not on record	27
Natural History Museum Rotterdamlocation not on record	15
Musée de Saint-Imierlocation not on record	13
Paro, BT	13
Tartu, EE	13
John May Museum of Natural Historylocation not on record	11
ZSMlocation not on record	9
Provincia di Livornolocation not on record	9
Bavarian State Collection of Zoologylocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	7
Research Collection of Bernd Muellerlocation not on record	4
Universität Zürich, Naturhistorisches Museumlocation not on record	4
Glarus, CH	4
Adam Mickiewicz University in Poznańlocation not on record	4
Naturmuseum Solothurnlocation not on record	4
Fribourg, CH	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
Research Collection of Gyula M. Laszlolocation not on record	2
SFRAlocation not on record	2
Naturmuseum Oltenlocation not on record	2
Research Collection of Georg Stiegellocation not on record	1
NHMOlocation not on record	1
Radicondoli, IT	1
Research Collection of Wolfgang Starklocation not on record	1

30 institutions · 564 of 659 vouchered records shown · 95 without an institution code

09Environmental DNA45 detections

Where the DNA of Agriopis bajaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries14

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map14 countries0

juniperus forestedge forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.80 °C 4.10–14.1

Seasonal swing summer↔winter16.0 °C

Max temp (day)11.0 °C 9.00–16.8

Min temp (night)5.10 °C -1.20–10.4

Precipitation69.0 mm/mo 49.3–124

Air humidity60.9 % 56.5–67.2

Moisture balance36.4 mm/mo

Vapour deficit371 Pa 323–645

Wind speed3.60 m/s

Cloud cover45.7 % 38.1–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriopis bajaria

At a glance

Sources6 archives

At a glance

Record type2 029 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 029 records