Agriophara platyscia

Lower, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agriophara

At a glance

Occurrence records75

Data sources7

Biological traits0

DNA specimens38

eDNA detections38

Sources7 archives

Databases and archives Agriophara platyscia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility75 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF75 records

Environmental DNA1 datasets · 1 countries38 detections

DNA & barcodingBOLD38 specimens

01Narrative

Agriophara platyscia is a moth in the family Depressariidae. It was described by Oswald Bertram Lower in 1908. It is found in Australia, where it has been recorded from Tasmania.Agriophara at Markku Savela's Lepidoptera and Some Other Life Forms. The wingspan is about 36 mm. The forewings are ashy-grey-whitish with a broad, more or less interrupted longitudinal shade, from the base to the apex, containing several short narrow blackish elongate streaks, those towards the termen (where the shade is darker) being especially prominent. The extreme costal edge is whitish, from before the middle to the apex. The hindwings are light greyish-fuscous.Transactions of the Royal Society of South Australia 32: 117

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriophara platyscia has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections38

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

31Amostly conserved

37Amostly conserved

59Tmostly conserved

184Gvariable

217Avariable

241Tmostly conserved

262Amostly conserved

310Gmostly conserved

337Cmostly conserved

379Gvariable

421Amostly conserved

470Tmostly conserved

500Tvariable

506Gmostly conserved

514Tmostly conserved

520Amostly conserved

544Tmostly conserved

547Gmostly conserved

550Amostly conserved

616Cmostly conserved

622Cmostly conserved

628Amostly conserved

631Avariable

646Cmostly conserved

658Cmostly conserved

AACCTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCTTTAAGCTTATTAATTCGAGCCGAATTAGGAAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes19

BINs2

Most divergent pair2.4%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriophara confertellasame genus9.9%Clemensia fuscasame order10.9%Eupselia callidyassame family10.9%Obila floccosariasame order10.9%Pero proteasame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type75 records

Wild obs. + sensor43

Museum / vouchered7

Other25

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 10≤10 km 2

12 georeferenced · 31 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Australian National Insect Collectionlocation not on record	1

3 institutions · 5 of 7 vouchered records shown · 2 without an institution code

09Environmental DNA38 detections

Where the DNA of Agriophara platyscia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 12.0–17.2

Seasonal swing summer↔winter14.5 °C

Max temp (day)23.0 °C 15.6–23.0

Min temp (night)11.7 °C 8.40–11.7

Precipitation48.1 mm/mo 42.2–50.5

Air humidity56.8 % 56.8–59.1

Moisture balance-58.5 mm/mo -58.5–-18.7

Vapour deficit850 Pa 574–850

Wind speed2.10 m/s 2.00–3.60

Cloud cover18.5 % 17.2–37.8

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)