Agriophara levis

(Meyrick, 1921) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agriophara

At a glance

Occurrence records6

Data sources7

Biological traits0

DNA specimens29

eDNA detections22

Sources7 archives

Databases and archives Agriophara levis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD29 specimens

01Narrative

Agriophara levis is a moth in the family Depressariidae. It was described by Edward Meyrick in 1921. It is found in Australia, where it has been recorded from Queensland.Agriophara at Markku Savela's Lepidoptera and Some Other Life Forms. The wingspan is 18–20 mm. The forewings are white with lilac-fuscous reflections, irrorated dark fuscous and with a short longitudinal line of blackish scales from the base of the costa, and other similar lines scattered in the disc. The stigmata are cloudy, of blackish irroration, the plical rather obliquely beyond the first discal. There is an oblique series of two or three small spots of dark irroration from the costa to the first and second discal respectively, and a strongly curved subterminal series of similar spots close to the margin. The hindwings are grey, paler towards the base.Exotic Microlepidoptera 2 (14): 446

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriophara levis has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes2

eDNA detections22

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

1Amostly conserved

40Avariable

43Avariable

49Cvariable

79Amostly conserved

82Cmostly conserved

106Tmostly conserved

139Amostly conserved

157Cmostly conserved

166Amostly conserved

200Gmostly conserved

208Amostly conserved

212Cvariable

262Avariable

268Tvariable

334Avariable

412Tmostly conserved

523Cvariable

589Tvariable

628Avariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCCTTAAGACTTTTAATTCGTGCTGAATTAGGAAACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes9

BINs2

Most divergent pair12.2%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriophara axestasame genus8.4%Agriophara leptosemelasame genus9.7%Victoria perornatasame order10.0%Rhesala fusiformissame order10.0%Tyrissa multilineasame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type6 records

Wild obs. + sensor4

Museum / vouchered2

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NSW Dept of Planning, Industry and Environmentlocation not on record	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA22 detections

Where the DNA of Agriophara levis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 15.6–23.3

Seasonal swing summer↔winter8.60 °C

Max temp (day)23.8 °C 20.0–24.7

Min temp (night)20.9 °C 11.4–20.9

Precipitation110 mm/mo 52.4–175

Air humidity61.6 % 56.9–63.3

Vapour deficit1,033 Pa 758–1,074

Cloud cover27.4 % 27.2–33.8

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)