Agrioglypta excelsalis

(Walker) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Agrioglypta

At a glance

Occurrence records805

Data sources7

Biological traits0

DNA specimens18

eDNA detections2

Sources7 archives

Databases and archives Agrioglypta excelsalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF805 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD18 specimens

01Narrative

Agrioglypta excelsalis is a moth in the family Crambidae described by Francis Walker in 1866. It is found on Sulawesi, Lifou Island, as well as in Bhutan, Thailand, Sumatra, Papua New Guinea, Samoa and in Australia, where it has been Western Australia, Queensland and northern New South Wales. The wingspan is about 20 mm. The forewings are white with a brown pattern. Both the forewings and hindwings have a white margin. The larvae feed on the leaves of Ficus species, including Ficus coronata, Ficus macrophylla and Ficus opposita. They feed from within a shelter made of leaves joined by silk.Herbison-Evans, Don & Crossley, Stella (1 February 2013). "Agrioglypta excelsalis (Walker, 1866)". Australian Caterpillars and their Butterflies and Moths. Retrieved 9 March 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrioglypta excelsalis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

22Amostly conserved

40Tmostly conserved

56Cmostly conserved

79Tmostly conserved

100Amostly conserved

136Tmostly conserved

142Cmostly conserved

163Amostly conserved

202Amostly conserved

220Cmostly conserved

247Cmostly conserved

268Cmostly conserved

274Cmostly conserved

277Amostly conserved

298Amostly conserved

318Cmostly conserved

319Cmostly conserved

364Tmostly conserved

370Amostly conserved

376Amostly conserved

400Cmostly conserved

401Tmostly conserved

415Gmostly conserved

418Cmostly conserved

470Amostly conserved

472Tmostly conserved

479Amostly conserved

490Tmostly conserved

499Amostly conserved

508Cmostly conserved

517Amostly conserved

553Gmostly conserved

578Cmostly conserved

580Tmostly conserved

634Tmostly conserved

637Amostly conserved

657Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTCTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.77%

Haplotypes4

BINs2

Most divergent pair5.2%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Talanga eurytusalissame family5.5%Agrioglypta eurytusalissame genus5.8%Agrioglypta itysalissame genus5.8%Cydalima diaphanalissame family6.2%Anarmodia repandalissame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type805 records

Wild obs. + sensor793

Museum / vouchered12

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 363≤1 km 261≤10 km 19>10 km 36

679 georeferenced · 114 without coordinates

Open the mapobservation + sensor793

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Insect Collectionlocation not on record	2
DPIlocation not on record	1
Tasmanian Museum & Art Gallerylocation not on record	1
Sydney, AU	1

4 institutions · 5 of 12 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Agrioglypta excelsalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 20.5–20.7

Seasonal swing summer↔winter9.70 °C

Max temp (day)23.8 °C 22.6–25.0

Min temp (night)17.7 °C 16.9–18.5

Precipitation89.5 mm/mo 45.9–133

Air humidity62.6 % 62.4–62.7

Moisture balance-37.0 mm/mo -86.5–12.6

Vapour deficit908 Pa 904–912

Wind speed2.40 m/s

Cloud cover26.0 % 25.6–26.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)