Agriocnemis pygmaea

(Rambur, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Agriocnemis

At a glance

Occurrence records6 207

Data sources7

Biological traits0

DNA specimens49

eDNA detections82

Sources7 archives

Databases and archives Agriocnemis pygmaea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 207 records

Environmental DNA1 datasets · 5 countries82 detections

DNA & barcodingBOLD49 specimens

01Narrative

Agriocnemis pygmaea (pygmy wisp) is a species of damselfly in the family Coenagrionidae. It is also known as wandering midget, pygmy dartlet or wandering wisp. It is well distributed across Asia and parts of Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agriocnemis pygmaea has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes2

eDNA detections82

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

63Cmostly conserved

69Amostly conserved

73Cmostly conserved

87Amostly conserved

99Amostly conserved

128Cmostly conserved

131Cmostly conserved

134Amostly conserved

161Tmostly conserved

204Cmostly conserved

211Tmostly conserved

213Gmostly conserved

216Gmostly conserved

219Gmostly conserved

270Amostly conserved

273Cmostly conserved

315Gmostly conserved

336Cmostly conserved

345Cmostly conserved

354Gmostly conserved

570Cmostly conserved

624Gmostly conserved

636Amostly conserved

ACTCTCTACTTAATATTTGGAGCATGAGCAGGTATAGTTGGAACTGCCCTAAGTATATTAATCCGGGTAGAACTAGGACAACCAGGATCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes17

BINs2

Most divergent pair2.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agriocnemis canuangosame genus12.0%Agriocnemis totosame genus12.0%Neoerythromma cultellatumsame family14.0%Coenagrion resolutumsame family14.9%Coenagrion interrogatumsame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type6 207 records

Wild obs. + sensor5 316

Museum / vouchered884

Other7

Range

Area of Occupancy AOO9 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 874≤1 km 980≤10 km 493>10 km 233

3 580 georeferenced · 1 736 without coordinates

Open the mapobservation + sensor5 316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 8≤1 km 477≤10 km 181>10 km 8

674 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence884

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	482
Australian National Fish Collectionlocation not on record	167
Natick, US	110
Washington, US	53
Sydney, AU	23
Museum and Art Gallery of the Northern Territorylocation not on record	16
Museums Victorialocation not on record	9
Kharazmi Universitylocation not on record	2
Cornell University Insect Collectionlocation not on record	2
National Museums of Kenyalocation not on record	2
East Lansing, US	2
Zürich, CH	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

13 institutions · 870 of 884 vouchered records shown · 14 without an institution code

09Environmental DNA82 detections

Where the DNA of Agriocnemis pygmaea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 20.7–28.1

Seasonal swing summer↔winter8.00 °C

Max temp (day)28.8 °C 25.2–31.9

Min temp (night)21.8 °C 15.8–25.1

Precipitation72.5 mm/mo 11.2–203

Air humidity59.8 % 52.8–66.0

Moisture balance-36.4 mm/mo -114–56.3

Vapour deficit1,254 Pa 1,009–1,570

Wind speed2.20 m/s 1.70–3.70

Cloud cover32.6 % 16.2–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agriocnemis pygmaea

At a glance

Sources7 archives

At a glance

Record type6 207 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 207 records