Agrilus subcinctus

Gory, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records148

Data sources8

Biological traits0

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Agrilus subcinctus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility148 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF148 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Agrilus subcinctus, the native ash borer, is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus subcinctus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P628 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 1 variable positions, in barcode order

188Gmostly conserved

GACACTTTATTTCATTTTTGGAGCCTGATCCGGAATAGTAGGAACAGCTCTTAGATTATTAATTCGAGCTGAGTTAGGAAACCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachys ovatussame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type148 records

Wild obs. + sensor78

Museum / vouchered70

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 40≤1 km 15≤10 km 5>10 km 7

67 georeferenced · 11 without coordinates

Open the mapobservation + sensor78

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 1>10 km 2

5 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	43
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	10
SOVTlocation not on record	4
Lexington, US	3
Chicago, US	2
University of Central Floridalocation not on record	2
College Station, US	1
Lubbock, US	1
Champaign, US	1

9 institutions · 67 of 70 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Agrilus subcinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Mixed habitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 17.5–17.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)22.4 °C 21.9–23.0

Min temp (night)13.8 °C 13.1–14.2

Precipitation84.7 mm/mo 77.2–90.8

Air humidity57.7 % 56.9–57.9

Moisture balance-57.7 mm/mo -61.8–-40.8

Vapour deficit855 Pa 843–869

Wind speed2.60 m/s 2.50–2.90

Cloud cover41.2 % 41.1–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)