Agrilus convexicollis

Redtenbacher, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records726

Data sources7

Biological traits0

DNA specimens18

eDNA detections18

Sources7 archives

Databases and archives Agrilus convexicollis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility726 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF726 records

Environmental DNA1 datasets · 4 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Agrilus convexicollis (лат.) — вид жуков-златок. Длина тела взрослых насекомых (имаго) 3,5—5 мм. Тело со спинной стороны тёмно-бронзовое или чёрное, иногда края переднеспинки с зеленоватым отблеском. Развиваются на различных лиственных деревьях.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus convexicollis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes2

eDNA detections18

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

1Gmostly conserved

31Cmostly conserved

34Tmostly conserved

40Amostly conserved

201Tmostly conserved

367Cmostly conserved

388Amostly conserved

415Amostly conserved

533Tmostly conserved

628Amostly conserved

GACTCTTTATTTCATATTCGGGGCATGGTCCGGTATAGTAGGGACAGCATTAAGACTTTTAATCCGAGCAGAATTAGGAAACCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes6

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plegaderus caesussame order17.2%Phaenops intrusasame family17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type726 records

Wild obs. + sensor251

Museum / vouchered420

Cultivated / captive1

Other54

Origin

Native132

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 64≤1 km 27≤10 km 114>10 km 5

210 georeferenced · 41 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 29≤1 km 51≤10 km 270

350 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence420

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	46
Musee d'Histoire Naturallelocation not on record	44
Bern, CH	32
MZLUlocation not on record	24
Brussels, BE	17
IFR-DNFlocation not on record	14
Geneva, CH	12
Zürich, CH	12
Muzeum Górnośląskie w Bytomiulocation not on record	10
Tallinn, EE	9
Provincia di Livornolocation not on record	9
EJCBlocation not on record	8
OMBSlocation not on record	6
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	6
RBINS-Scientific Heritagelocation not on record	5
ZSMlocation not on record	4
Uniwersytet Wrocławskilocation not on record	4
Museo civico Brancaleoni di Piobbicolocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Slovenske Narodne Muzeumlocation not on record	2
JKSlocation not on record	1
TMLSlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Salzburg, AT	1
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	1
Paro, BT	1
Frauenfeld, CH	1
RKPSlocation not on record	1
JCNSlocation not on record	1
ISCKlocation not on record	1

30 institutions · 278 of 420 vouchered records shown · 138 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Agrilus convexicollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map4 countries0

WandrandForestWaldrand

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 5.90–18.1

Seasonal swing summer↔winter20.5 °C

Max temp (day)12.1 °C 9.70–22.4

Min temp (night)4.80 °C 1.10–13.2

Precipitation82.6 mm/mo 57.0–82.6

Air humidity64.9 % 58.6–65.9

Moisture balance28.8 mm/mo -56.0–28.8

Vapour deficit432 Pa 370–861

Wind speed2.30 m/s 1.80–4.00

Cloud cover43.4 % 30.4–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)