Agrilus betuleti

(Ratzeberg, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records539

Data sources8

Biological traits0

DNA specimens15

eDNA detections16

Sources8 archives

Databases and archives Agrilus betuleti's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility539 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF539 records

Environmental DNA1 datasets · 5 countries16 detections

DNA & barcodingBOLD15 specimens

01Narrative

Agrilus betuleti is a species of beetle in the family Buprestidae. It is found in Europe, and was first described as Buprestis betuleti by Julius Theodor Christian Ratzeburg in 1837

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus betuleti has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections16

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

58Gmostly conserved

91Tmostly conserved

238Gmostly conserved

250Cmostly conserved

303Cvariable

376Tmostly conserved

451Cmostly conserved

616Tmostly conserved

631Avariable

655Tmostly conserved

AACCCTTTACTTTTTCTTCGGGGCTTGATCAGGAATGGTAGGAACAGCATTGAGATTGTTAATTCGCGCTGAGCTAGGAAATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes7

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus masculinussame genus14.6%Chrysobothris caurinasame family16.1%Chrysobothris carinipennissame family16.1%Aphanisticus elongatussame family16.4%Chrysobothris leechisame family16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type539 records

Wild obs. + sensor176

Museum / vouchered342

Other21

Origin

Native19

Range

Area of Occupancy AOO1 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 67≤1 km 42≤10 km 45>10 km 1

155 georeferenced · 21 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 102≤1 km 96≤10 km 85>10 km 5

288 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence342

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	145
IFR-DNFlocation not on record	39
Tallinn, EE	14
Muzeum Górnośląskie w Bytomiulocation not on record	14
Bern, CH	11
Brussels, BE	9
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	8
Helsinki, FI	7
Musee d'Histoire Naturallelocation not on record	6
Zürich, CH	6
Trondheim, NO	6
Salzburg, AT	5
MZLUlocation not on record	5
Provincia di Livornolocation not on record	5
Copenhagen, DK	4
EJCBlocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
NTNU-VMlocation not on record	3
Tartu, EE	3
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Oulu, FI	1
NHMOlocation not on record	1
BioFokuslocation not on record	1
Tilburg, NL	1
Olocation not on record	1
LSMlocation not on record	1
NMBU:MINAlocation not on record	1
neflocation not on record	1

29 institutions · 310 of 342 vouchered records shown · 30 without an institution code

09Environmental DNA16 detections

Where the DNA of Agrilus betuleti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map5 countries0

on Betula pendula between the rails

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 4.80–15.1

Seasonal swing summer↔winter25.6 °C

Max temp (day)18.1 °C 7.70–19.2

Min temp (night)9.60 °C 1.30–10.4

Precipitation102 mm/mo 57.1–125

Air humidity63.2 % 57.9–64.9

Moisture balance1.80 mm/mo -45.5–6.20

Vapour deficit578 Pa 366–689

Wind speed4.00 m/s 2.30–4.20

Cloud cover47.0 % 33.6–52.6

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)