Agrilus auricollis

Kiesenwetter, 1857 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records176

Data sources7

Biological traits0

DNA specimens14

eDNA detections12

Sources7 archives

Databases and archives Agrilus auricollis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF176 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD14 specimens

01Narrative

Узкотелая златка ильмовая — вид жуков из семейства златок. Длина тела имаго 6—7 мм. Переднеспинка золотисто-зелёная или медно-красная. Надкрылья оливково-зелёные, зелёно-синие, реже голубые, с узкой каёмкой из белых блестящих волосков на вершинах, которая продолжается двумя или тремя рядами волосков вдоль шва в задней половине надкрылий. Развиваются на ильме.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus auricollis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes2

eDNA detections12

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P638 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 129 variable positions, in barcode order

1Tmostly conserved

14Amostly conserved

22Cmostly conserved

25Cmostly conserved

31Cmostly conserved

34Amostly conserved

46Cmostly conserved

49Cmostly conserved

56Tmostly conserved

58Amostly conserved

67Amostly conserved

82Cmostly conserved

85Gmostly conserved

88Gmostly conserved

100Amostly conserved

106Cmostly conserved

112Cmostly conserved

115Tmostly conserved

130Amostly conserved

136Tmostly conserved

139Amostly conserved

142Cmostly conserved

154Cmostly conserved

157Tmostly conserved

166Amostly conserved

172Tmostly conserved

181Amostly conserved

190Amostly conserved

197Tmostly conserved

199Amostly conserved

202Amostly conserved

205Cmostly conserved

206Tmostly conserved

208Amostly conserved

214Amostly conserved

220Cmostly conserved

223Amostly conserved

226Tmostly conserved

235Cmostly conserved

238Amostly conserved

241Gmostly conserved

250Cmostly conserved

262Amostly conserved

265Cmostly conserved

268Gvariable

274Cmostly conserved

278Tmostly conserved

280Amostly conserved

283Tmostly conserved

284Tmostly conserved

286Amostly conserved

295Amostly conserved

302Tmostly conserved

303Tmostly conserved

304Amostly conserved

307Amostly conserved

316Gmostly conserved

322Amostly conserved

328Gmostly conserved

350Gmostly conserved

358Cmostly conserved

364Cmostly conserved

367Tmostly conserved

375Cmostly conserved

376Tmostly conserved

379Cmostly conserved

388Gmostly conserved

391Amostly conserved

400Gmostly conserved

401Cmostly conserved

406Tmostly conserved

409Gmostly conserved

412Amostly conserved

418Tmostly conserved

433Gmostly conserved

436Amostly conserved

442Tmostly conserved

451Amostly conserved

454Amostly conserved

457Amostly conserved

466Gmostly conserved

469Amostly conserved

473Tmostly conserved

474Cmostly conserved

478Tmostly conserved

484Cmostly conserved

485Cmostly conserved

487Tmostly conserved

494Amostly conserved

495Cmostly conserved

496Cmostly conserved

499Tmostly conserved

503Cmostly conserved

505Gmostly conserved

508Tmostly conserved

514Amostly conserved

517Tmostly conserved

518Amostly conserved

520Amostly conserved

523Cmostly conserved

526Cmostly conserved

529Tmostly conserved

532Gmostly conserved

535Amostly conserved

538Gmostly conserved

539Cmostly conserved

541Cmostly conserved

544Amostly conserved

547Tmostly conserved

548Cmostly conserved

550Amostly conserved

553Tmostly conserved

557Tmostly conserved

559Amostly conserved

574Tmostly conserved

577Gmostly conserved

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

583Amostly conserved

+9 more variable positions not shown

TACACTTTATTTTATTTTTGGCGCCTGGTCCGGAATAGTAGGCACCGCCCTTAGATTATTAATTCGAGCAGAACTAGGAAACCCGGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.8%

Haplotypes3

BINs2

Most divergent pair20.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrilus quadrisignatussame genus13.6%Agrilus kubanisame genus15.5%Agrilus coxalissame genus16.0%Tachinus instabilissame order16.2%Brachys ovatussame family16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type176 records

Wild obs. + sensor57

Museum / vouchered104

Other15

Origin

Native24

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 18≤1 km 7≤10 km 6>10 km 2

33 georeferenced · 24 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 5≤10 km 55>10 km 1

61 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	17
EJCBlocation not on record	13
Musee d'Histoire Naturallelocation not on record	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
Paro, BT	5
IFR-DNFlocation not on record	5
Muzeum Górnośląskie w Bytomiulocation not on record	5
Bern, CH	4
Tallinn, EE	4
Zürich, CH	2
Provincia di Livornolocation not on record	2
Salzburg, AT	1
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
ZSCBlocation not on record	1
MZLUlocation not on record	1

16 institutions · 75 of 104 vouchered records shown · 28 without an institution code

09Environmental DNA12 detections

Where the DNA of Agrilus auricollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.90–11.1

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.3 °C 9.70–15.7

Min temp (night)6.70 °C 1.10–6.70

Precipitation47.9 mm/mo 47.9–90.4

Air humidity59.3 % 59.3–65.9

Moisture balance-24.0 mm/mo -24.0–28.8

Vapour deficit629 Pa 370–629

Wind speed2.70 m/s 1.80–2.70

Cloud cover45.5 % 36.7–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)