Agrilus arcuatus

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilus

At a glance

Occurrence records390

Data sources8

Biological traits0

DNA specimens9

eDNA detections12

Sources8 archives

Databases and archives Agrilus arcuatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility390 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF390 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD9 specimens

01Narrative

Agrilus arcuatus is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilus arcuatus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Diversity (π)5.2%

Haplotypes1

BIN1

Where individuals differ — all 119 variable positions, in barcode order

1Tmostly conserved

4Tmostly conserved

5Tmostly conserved

7Gmostly conserved

16Tmostly conserved

19Tmostly conserved

25Tmostly conserved

28Gmostly conserved

29Gmostly conserved

31Tmostly conserved

34Gmostly conserved

43Amostly conserved

50Tmostly conserved

56Cmostly conserved

58Amostly conserved

61Amostly conserved

67Amostly conserved

70Cmostly conserved

79Gmostly conserved

82Cmostly conserved

85Cmostly conserved

92Tmostly conserved

94Gmostly conserved

100Cmostly conserved

106Tmostly conserved

109Gmostly conserved

127Gmostly conserved

133Cmostly conserved

136Cmostly conserved

139Gmostly conserved

160Amostly conserved

169Amostly conserved

175Gmostly conserved

181Gmostly conserved

184Cmostly conserved

193Cmostly conserved

197Cmostly conserved

205Amostly conserved

206Cmostly conserved

211Amostly conserved

212Cmostly conserved

223Tmostly conserved

226Tmostly conserved

238Gmostly conserved

247Tmostly conserved

259Cmostly conserved

262Amostly conserved

277Tmostly conserved

280Gmostly conserved

282Cmostly conserved

283Cmostly conserved

286Gmostly conserved

289Tmostly conserved

292Tmostly conserved

304Amostly conserved

316Gmostly conserved

328Amostly conserved

337Amostly conserved

343Cmostly conserved

346Amostly conserved

349Gmostly conserved

358Cmostly conserved

364Amostly conserved

367Cmostly conserved

373Gmostly conserved

376Cmostly conserved

385Tmostly conserved

388Amostly conserved

403Gmostly conserved

418Tmostly conserved

421Cmostly conserved

427Cmostly conserved

428Cmostly conserved

433Cmostly conserved

436Cmostly conserved

439Tmostly conserved

442Cmostly conserved

451Cmostly conserved

475Gmostly conserved

482Amostly conserved

484Gmostly conserved

485Tmostly conserved

490Cmostly conserved

496Tmostly conserved

499Amostly conserved

500Cmostly conserved

502Gmostly conserved

505Amostly conserved

511Amostly conserved

514Amostly conserved

517Cmostly conserved

520Cmostly conserved

526Tmostly conserved

530Cmostly conserved

532Tmostly conserved

533Cmostly conserved

535Gmostly conserved

538Amostly conserved

541Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Amostly conserved

550Tmostly conserved

553Gmostly conserved

562Tmostly conserved

565Gmostly conserved

574Cmostly conserved

578Cmostly conserved

581Tmostly conserved

583Amostly conserved

586Tmostly conserved

601Cmostly conserved

604Cmostly conserved

607Gmostly conserved

622Amostly conserved

628Amostly conserved

631Amostly conserved

634Tmostly conserved

637Tmostly conserved

TACTTTGTACTTTATTTTTGGAGCTTGGGCTGGGATAGTAGGAACAGCTTTAAGACTACTAATTCGAGCCGAACTAGGGAACCCCGGGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type390 records

Wild obs. + sensor9

Museum / vouchered381

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 2≤10 km 1>10 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 1

7 georeferenced · 374 without coordinates

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	138
Chicago, US	109
St. Paul, US	60
Agency of Natural Resources Department of Forests, Parks and Recreationlocation not on record	43
SOVTlocation not on record	12
Denver, US	2
CUlocation not on record	1
Espace pour la vielocation not on record	1
WIlocation not on record	1
Washington, US	1
University of Central Floridalocation not on record	1
ASUlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Lexington, US	1

14 institutions · 372 of 381 vouchered records shown · 7 without an institution code

09Environmental DNA12 detections

Where the DNA of Agrilus arcuatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C -4.40–20.9

Seasonal swing summer↔winter30.5 °C

Max temp (day)26.1 °C -1.10–26.1

Min temp (night)16.2 °C -6.50–16.2

Precipitation93.3 mm/mo 54.0–93.3

Air humidity58.3 % 58.3–65.1

Moisture balance-60.7 mm/mo -63.7–-1.80

Vapour deficit1,031 Pa 269–1,031

Wind speed3.40 m/s 3.40–5.60

Cloud cover44.4 % 43.8–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)