Agrilaxia flavimana

(Gory, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Agrilaxia

At a glance

Occurrence records164

Data sources7

Biological traits0

DNA specimens7

eDNA detections2

Sources7 archives

Databases and archives Agrilaxia flavimana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agrilaxia flavimana is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrilaxia flavimana has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

1Avariable

34Tmostly conserved

46Cmostly conserved

49Amostly conserved

50Tmostly conserved

52Amostly conserved

64Cmostly conserved

67Cmostly conserved

74Cmostly conserved

79Tmostly conserved

88Cmostly conserved

100Tmostly conserved

106Cmostly conserved

124Tmostly conserved

127Tmostly conserved

133Tmostly conserved

154Cmostly conserved

166Gvariable

169Amostly conserved

172Cmostly conserved

187Cmostly conserved

190Amostly conserved

196Gmostly conserved

200Gmostly conserved

205Cmostly conserved

206Cmostly conserved

214Avariable

217Gvariable

232Tmostly conserved

238Tmostly conserved

241Amostly conserved

274Cmostly conserved

277Cmostly conserved

278Cmostly conserved

283Amostly conserved

284Cmostly conserved

286Cmostly conserved

290Cmostly conserved

325Cmostly conserved

340Tvariable

343Cmostly conserved

346Tmostly conserved

352Cmostly conserved

367Cvariable

379Amostly conserved

388Gmostly conserved

394Cmostly conserved

406Cmostly conserved

407Tmostly conserved

409Amostly conserved

412Amostly conserved

436Amostly conserved

451Cmostly conserved

454Tmostly conserved

463Tvariable

471Cmostly conserved

474Cmostly conserved

484Cmostly conserved

493Cmostly conserved

500Cmostly conserved

508Tmostly conserved

520Tmostly conserved

526Tmostly conserved

529Cmostly conserved

538Cmostly conserved

541Gmostly conserved

542Cmostly conserved

550Cmostly conserved

562Tmostly conserved

581Cmostly conserved

589Cmostly conserved

595Cmostly conserved

607Cmostly conserved

616Cmostly conserved

622Amostly conserved

640Tmostly conserved

646Cmostly conserved

658Cmostly conserved

AACATTATATTTTATTTTTGGTGCTTGATCAGGTATAGTAGGAACCGCATTAAGATTATTAATCCGCACAGAACTAGGTAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.0%

Haplotypes5

BINs2

Most divergent pair11.9%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phaenops cyaneasame family14.9%Nudobius lentussame order15.2%Falagria sulcatulasame order15.2%Anthaxia aeneogastersame family16.0%Spercheus emarginatussame order16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type164 records

Wild obs. + sensor111

Museum / vouchered53

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 53≤1 km 26>10 km 10

89 georeferenced · 22 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 8≤10 km 6>10 km 1

15 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	20
University of Guelphlocation not on record	12
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	8
ASUlocation not on record	5
Denver, US	2
OSUClocation not on record	2
CUlocation not on record	1
Lubbock, US	1
Wuzhou, CN	1
University of Central Floridalocation not on record	1

10 institutions · 53 of 53 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Agrilaxia flavimana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)