Agoo dahliana

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Derbidae/Agoo

At a glance

Occurrence records2

Data sources4

Biological traits0

DNA specimens9

eDNA detections9

Sources4 archives

Databases and archives Agoo dahliana's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agoo dahliana has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

27Cmostly conserved

39Amostly conserved

159Tmostly conserved

204Amostly conserved

285Tmostly conserved

312Amostly conserved

363Cmostly conserved

435Cmostly conserved

471Tmostly conserved

653Tmostly conserved

ATATACTTCTTAATAGGAATTTGATCCAGATTTATTGGAACTATAAGAAGAATAATTATTCGAATAGAATTAATTCAACCAGGATCAATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair0.92%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Derbe westwoodisame family15.5%Desudaba danaesame order16.1%Diareusa annularissame order16.8%Aracynthus sanguineussame order16.9%Hypaepa illuminatasame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 records

Wild obs. + sensor1

Museum / vouchered1

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Floridalocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Agoo dahliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 25.7–26.3

Seasonal swing summer↔winter1.80 °C

Max temp (day)27.9 °C 27.4–27.9

Min temp (night)24.0 °C 23.6–24.2

Precipitation225 mm/mo 209–394

Air humidity64.9 % 64.7–69.7

Moisture balance57.6 mm/mo 46.5–268

Vapour deficit1,157 Pa 1,022–1,182

Wind speed1.30 m/s 0.9–1.30

Cloud cover16.7 % 15.4–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)