Agonum palustre

Goulet, 1969 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records271

Data sources7

Biological traits0

DNA specimens38

eDNA detections12

Sources7 archives

Databases and archives Agonum palustre's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF271 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD38 specimens

01Narrative

Agonum palustre is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum palustre has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

10Cvariable

40Gvariable

43Gmostly conserved

52Gvariable

58Amostly conserved

59Cmostly conserved

70Tmostly conserved

82Cmostly conserved

85Cmostly conserved

88Amostly conserved

100Amostly conserved

103Tmostly conserved

106Cmostly conserved

112Tmostly conserved

139Amostly conserved

154Cmostly conserved

172Cmostly conserved

181Amostly conserved

184Gmostly conserved

217Amostly conserved

220Tmostly conserved

223Tmostly conserved

244Gvariable

268Tmostly conserved

271Cmostly conserved

286Cmostly conserved

295Amostly conserved

302Tmostly conserved

343Tmostly conserved

347Cmostly conserved

358Gvariable

370Amostly conserved

401Tmostly conserved

415Avariable

433Tvariable

472Tmostly conserved

484Amostly conserved

514Cvariable

523Tmostly conserved

562Tvariable

595Tmostly conserved

616Cvariable

622Gmostly conserved

628Amostly conserved

631Gmostly conserved

AACATTATACTTTATTTTTGGTGCATGAGCTGGAATAGTGGGGACTTCATTGAGTATACTAATTCGAGCTGAATTAGGAAACCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes10

BINs2

Most divergent pair5.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum canadensesame genus3.8%Agonum consimilesame genus4.6%Agonum lutulentumsame genus4.9%Agonum scitulumsame genus6.1%Agonum micanssame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type271 records

Wild obs. + sensor12

Museum / vouchered259

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 8≤1 km 2≤10 km 1

11 georeferenced · 1 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 37≤1 km 6≤10 km 80>10 km 1

124 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence259

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	77
Tempe, US	44
Cambridge, US	11
Saint John, CA	9
University of Alberta Museums (UAM)location not on record	8
Espace pour la vielocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Provo, US	4
Decorah, US	3
NEON Biorepository at Arizona State Universitylocation not on record	3
SOVTlocation not on record	3
University of Guelphlocation not on record	2
Canadian Centre for DNA Barcodinglocation not on record	1

13 institutions · 179 of 259 vouchered records shown · 80 without an institution code

09Environmental DNA12 detections

Where the DNA of Agonum palustre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

deciduousForestOak savannaWetlandRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 16.5–24.1

Seasonal swing summer↔winter26.4 °C

Max temp (day)22.1 °C 20.7–26.5

Min temp (night)14.2 °C 13.2–22.5

Precipitation88.5 mm/mo 82.9–108

Air humidity58.1 % 57.7–59.8

Moisture balance-57.7 mm/mo -110–-9.10

Vapour deficit855 Pa 753–1,262

Wind speed2.90 m/s 2.80–5.70

Cloud cover41.1 % 35.3–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)