Agonum gratiosum

(Mannerheim, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records1 488

Data sources6

Biological traits0

DNA specimens108

eDNA detections91

Sources6 archives

Databases and archives Agonum gratiosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI91 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics108 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 488 records

Environmental DNA1 datasets · 2 countries91 detections

DNA & barcodingBOLD108 specimens

01Narrative

Agonum gratiosum is a species of ground beetle in the Platyninae subfamily. It is found in Chukotka region, Russia and Kamchatka, and also in Alaska, United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding108 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum gratiosum has left across the world's sequence archives.

At a glance

DNA specimens108

BINs3

Marker genes1

eDNA detections91

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

13Cvariable

76Gmostly conserved

82Cmostly conserved

85Amostly conserved

235Cmostly conserved

271Tmostly conserved

337Amostly conserved

577Gmostly conserved

622Cmostly conserved

625Amostly conserved

637Amostly conserved

AACATTATATTTCATTTTTGGTGCATGAGCTGGAATAGTAGGAACTTCATTAAGTATACTAATTCGAGCTGAATTGGGAAACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes16

BINs3

Most divergent pair9.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum thoreyisame genus5.0%Agonum lutulentumsame genus6.5%Agonum exaratumsame genus6.7%Agonum scitulumsame genus7.0%Agonum micanssame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 488 records

Wild obs. + sensor16

Museum / vouchered1 472

Range

Area of Occupancy AOO1 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 14≤10 km 1

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 199≤1 km 104≤10 km 213>10 km 16

532 georeferenced · 940 without coordinates

Open the institutions mapphysical evidence1 472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	426
Tempe, US	195
McGill Universitylocation not on record	156
Espace pour la vielocation not on record	98
Edmonton, CA	96
Royal Saskatchewan Museumlocation not on record	65
Saint John, CA	63
WIlocation not on record	44
Decorah, US	42
OSUClocation not on record	24
Cambridge, US	19
Kushiro City Museumlocation not on record	18
Veterinary Laboratory Agencylocation not on record	17
NEON Biorepository at Arizona State Universitylocation not on record	16
FEBlocation not on record	15
Essig Museum of Entomologylocation not on record	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Provo, US	8
University of Guelphlocation not on record	7
College Station, US	3
University of Alabamalocation not on record	3
National Ecological Observatory Network, United Stateslocation not on record	2
Helsinki, FI	2
Department of Microbiology, Prince of Songkla Universitylocation not on record	2
McGill University, Lyman Entomological Museumlocation not on record	1
Colorado State Universitylocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
SOVTlocation not on record	1
University Park, US	1

29 institutions · 1 344 of 1 472 vouchered records shown · 127 without an institution code

09Environmental DNA91 detections

Where the DNA of Agonum gratiosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found91

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 91 detections have coordinates

Open the map2 countries0

woodyWetlandsshrubScrubForest5. Wetlands (inland) | 5.4. Bogs, Marshes, S…deciduousForest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.2–19.6

Seasonal swing summer↔winter29.7 °C

Max temp (day)22.7 °C 14.5–25.9

Min temp (night)13.2 °C 6.70–16.1

Precipitation91.7 mm/mo 69.2–118

Air humidity58.7 % 56.1–60.5

Moisture balance-33.4 mm/mo -53.2–26.7

Vapour deficit824 Pa 541–972

Wind speed2.60 m/s 2.30–4.20

Cloud cover38.8 % 36.6–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 89 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonum gratiosum

At a glance

Sources6 archives

At a glance

Record type1 488 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 488 records