Agonoscena succincta

(Heeger, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphalaridae/Agonoscena

At a glance

Occurrence records15

Data sources4

Biological traits0

DNA specimens3

eDNA detections0

Sources4 archives

Databases and archives Agonoscena succincta's data was compiled from.

GBIFGlobal Biodiversity Information Facility15 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF15 records

DNA & barcodingBOLD3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonoscena succincta has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P593 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.11%

Haplotypes2

BIN1

Most divergent pair0.17%

Where individuals differ — all 1 variable positions, in barcode order

26Tvariable

GACTTGAATTAAGTCAATCATCAAATCTTATTTTAAATGACCAAATTTATAATACAATCGTTACAGCACATGCTTTCATCATAATTTTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonoscena targioniisame genus5.4%Megagonoscena gallicolasame family16.5%Ceanothia aculeatasame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor13

Museum / vouchered2

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 1

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Natural History Museum Bucharestlocation not on record	2

1 institutions · 2 of 2 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)