Agonoscelis versicoloratus

(Turton) Turton · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Agonoscelis

At a glance

Occurrence records495

Data sources5

Biological traits0

DNA specimens13

eDNA detections17

Sources5 archives

Databases and archives Agonoscelis versicoloratus's data was compiled from.

GBIFGlobal Biodiversity Information Facility495 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF495 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD13 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonoscelis versicoloratus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 121 variable positions, in barcode order

5Cmostly conserved

7Tmostly conserved

10Tmostly conserved

13Cmostly conserved

14Cmostly conserved

19Cvariable

22Amostly conserved

28Avariable

31Amostly conserved

43Amostly conserved

46Cmostly conserved

58Cmostly conserved

61Cmostly conserved

64Tmostly conserved

67Tvariable

70Tmostly conserved

74Cmostly conserved

79Gmostly conserved

85Cvariable

94Cmostly conserved

100Amostly conserved

106Tmostly conserved

112Cmostly conserved

115Cmostly conserved

121Amostly conserved

122Amostly conserved

124Tmostly conserved

142Cmostly conserved

151Cmostly conserved

154Tmostly conserved

157Tmostly conserved

163Tmostly conserved

169Tmostly conserved

172Tmostly conserved

181Gmostly conserved

184Gmostly conserved

190Amostly conserved

193Tmostly conserved

197Tmostly conserved

199Avariable

202Amostly conserved

205Tmostly conserved

206Tmostly conserved

211Amostly conserved

217Amostly conserved

232Cmostly conserved

247Cmostly conserved

256Tmostly conserved

259Tmostly conserved

265Avariable

266Tmostly conserved

268Amostly conserved

277Cmostly conserved

284Tmostly conserved

287Cmostly conserved

295Amostly conserved

298Tmostly conserved

301Cmostly conserved

304Cmostly conserved

307Cmostly conserved

313Amostly conserved

319Cmostly conserved

322Gvariable

334Amostly conserved

335Gmostly conserved

340Cmostly conserved

349Amostly conserved

355Amostly conserved

358Tmostly conserved

359Amostly conserved

361Tmostly conserved

367Tmostly conserved

376Tmostly conserved

379Cmostly conserved

382Tmostly conserved

385Tmostly conserved

388Avariable

391Amostly conserved

394Cmostly conserved

397Tvariable

400Cmostly conserved

401Cmostly conserved

403Cvariable

407Cmostly conserved

418Cvariable

424Tmostly conserved

427Tvariable

428Cmostly conserved

430Tmostly conserved

433Tmostly conserved

436Amostly conserved

442Tmostly conserved

451Amostly conserved

460Tmostly conserved

466Amostly conserved

469Gvariable

472Cmostly conserved

473Gmostly conserved

475Tmostly conserved

478Tmostly conserved

483Cmostly conserved

487Amostly conserved

493Amostly conserved

495Tmostly conserved

505Cmostly conserved

517Tmostly conserved

520Amostly conserved

521Amostly conserved

523Tmostly conserved

539Tmostly conserved

547Amostly conserved

548Tmostly conserved

568Cvariable

578Tmostly conserved

580Amostly conserved

592Tmostly conserved

604Tmostly conserved

607Tmostly conserved

628Gvariable

634Cvariable

+1 more variable positions not shown

AACCCTTTATTTCCTATTCGGAATATGAGCAGGAATAGTAGGATCCGCCATAAGAATCATCATTCGTATTGAACTAGGGCAACCCGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes6

BINs3

Most divergent pair16.9%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Derula flavoguttatasame family13.9%Acesines brevicepssame family14.2%Lelia decempunctatasame family14.3%Bathycoelia distinctasame family15.3%Macrorhaphis acutasame family15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type495 records

Wild obs. + sensor434

Museum / vouchered61

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 253≤1 km 64≤10 km 26>10 km 20

363 georeferenced · 71 without coordinates

Open the mapobservation + sensor434

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 61 records without

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	20
Durban Natural Science Museumlocation not on record	15
Cape Town, ZA	8
KwaZulu-Natal Museumlocation not on record	3

4 institutions · 46 of 61 vouchered records shown · 15 without an institution code

09Environmental DNA17 detections

Where the DNA of Agonoscelis versicoloratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

4. Native Grassland|4.6. Subtropical/Tropica…4. Native Grassland | 4.6. Subtropical/Tropi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 19.0–25.5

Seasonal swing summer↔winter9.90 °C

Max temp (day)25.9 °C 24.0–30.0

Min temp (night)16.2 °C 12.0–23.4

Precipitation89.7 mm/mo 46.0–117

Air humidity55.5 % 51.4–62.6

Moisture balance-46.1 mm/mo

Vapour deficit1,153 Pa 1,007–1,455

Wind speed2.60 m/s

Cloud cover28.4 % 16.3–32.5

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)