Agonopterix thapsiella

Zeller, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records54

Data sources7

Biological traits0

DNA specimens37

eDNA detections39

Sources7 archives

Databases and archives Agonopterix thapsiella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF54 records

Environmental DNA1 datasets · 12 countries39 detections

DNA & barcodingBOLD37 specimens

01Narrative

Agonopterix thapsiella is a moth of the family Depressariidae. It is found in France, Spain, Portugal, Italy, Hungary, Greece and on Sardinia, Sicily and Crete.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix thapsiella has left across the world's sequence archives.

At a glance

DNA specimens37

BINs2

Marker genes1

eDNA detections39

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

82Cvariable

172Tmostly conserved

187Tmostly conserved

202Amostly conserved

229Avariable

235Cmostly conserved

238Avariable

262Amostly conserved

340Tvariable

529Amostly conserved

530Cmostly conserved

544Gvariable

565Tvariable

571Cmostly conserved

616Tmostly conserved

622Tmostly conserved

628Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes16

BINs2

Most divergent pair2.0%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix cadurciellasame genus2.7%Agonopterix ivinskisisame genus2.9%Agonopterix leucadensissame genus2.9%Agonopterix kayseriensissame genus3.2%Agonopterix ochrocephalasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor37

Museum / vouchered17

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 10≤1 km 20≤10 km 6

36 georeferenced · 1 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZAF-UMUlocation not on record	6
Tartu, EE	2

2 institutions · 8 of 17 vouchered records shown · 9 without an institution code

09Environmental DNA39 detections

Where the DNA of Agonopterix thapsiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 13.6–22.8

Seasonal swing summer↔winter18.8 °C

Max temp (day)21.0 °C 17.1–26.5

Min temp (night)12.4 °C 7.90–17.9

Precipitation32.6 mm/mo 2.60–86.9

Air humidity54.4 % 48.6–63.1

Moisture balance-94.7 mm/mo

Vapour deficit897 Pa 648–1,216

Wind speed3.50 m/s

Cloud cover30.4 % 17.6–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)