Agonopterix silerella

Stainton, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records21

Data sources7

Biological traits0

DNA specimens24

eDNA detections24

Sources7 archives

Databases and archives Agonopterix silerella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 5 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Agonopterix silerella is a moth of the family Depressariidae. It is found in Italy, Switzerland and Austria. A leaf of Siler aquilegifolium attacked by larva Larva The wingspan is 9–11 mm. The larvae have been recorded feeding on Laserpitium siler and Laser trilobum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix silerella has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections24

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

124Cmostly conserved

385Tmostly conserved

542Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes8

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus2.9%Agonopterix carduncellisame genus2.9%Agonopterix anticellasame genus3.0%Agonopterix multiplicellasame genus3.0%Agonopterix latipennellasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type21 records

Wild obs. + sensor2

Museum / vouchered14

Other5

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	4
Salzburg, AT	1

2 institutions · 5 of 14 vouchered records shown · 9 without an institution code

09Environmental DNA24 detections

Where the DNA of Agonopterix silerella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map5 countries0

dry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 6.30–15.8

Seasonal swing summer↔winter20.1 °C

Max temp (day)15.8 °C 10.6–20.1

Min temp (night)6.10 °C 0.2–10.4

Precipitation127 mm/mo 72.8–266

Air humidity60.3 % 56.9–63.8

Moisture balance5.20 mm/mo -46.3–153

Vapour deficit560 Pa 364–772

Wind speed2.80 m/s 2.00–3.70

Cloud cover37.4 % 35.3–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)