Agonopterix posticella

Walsingham, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records42

Data sources7

Biological traits0

DNA specimens9

eDNA detections5

Sources7 archives

Databases and archives Agonopterix posticella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD9 specimens

01Narrative

Agonopterix posticella is a moth in the family Depressariidae. It was described by Walsingham in 1881. It is found in North America, where it has been recorded from Washington to California and in Wyoming and Colorado.mothphotographersgroup The wingspan is 17–21 mm. The forewings are dull whitish ochreous, irrorated with black and fuscous and suffused with reddish. There is a blackish-fuscous spot on the costa at the base and on the inner angle near the base. There is also a black discal spot at the basal third, followed by a similar one at the end of the cell, as well as a fuscous blotch on the inner margin, before the tornus. The hindwings are light greyish fuscous.Proceedings of the United States National Museum The larvae feed on Psoralea physodes, Psoralea macrostachya and Psoralea tenuiflora.Agonopterix at funet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix posticella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

49Tmostly conserved

133Amostly conserved

184Tmostly conserved

202Gmostly conserved

410Gmostly conserved

412Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTCTAAGATTATTAATTCGTGCAGAATTAGGTAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes3

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix bipunctosasame genus6.1%Agonopterix kyzyltashensissame genus6.4%Agonopterix straminellasame genus6.4%Agonopterix ivinskisisame genus6.5%Agonopterix carduncellisame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor7

Museum / vouchered35

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
University of Alberta Museums (UAM)location not on record	14
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Philadelphia, US	1
Mississippi State, US	1

5 institutions · 35 of 35 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Agonopterix posticella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.8–18.1

Seasonal swing summer↔winter28.1 °C

Max temp (day)20.2 °C 20.2–25.4

Min temp (night)8.10 °C 8.10–10.9

Precipitation37.0 mm/mo 18.1–37.0

Air humidity52.0 % 39.0–52.0

Moisture balance-54.5 mm/mo -127–-54.5

Vapour deficit718 Pa 718–1,335

Wind speed4.50 m/s 3.00–4.50

Cloud cover40.1 % 28.2–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)