Agonopterix pallorella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records455

Data sources6

Biological traits0

DNA specimens30

eDNA detections42

Sources6 archives

Databases and archives Agonopterix pallorella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF455 records

Environmental DNA3 datasets · 15 countries42 detections

DNA & barcodingBOLD30 specimens

01Narrative

De zwartstreepkaartmot is een vlinder uit de familie grasmineermotten (Elachistidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1839 door Zeller. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix pallorella has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes1

eDNA detections42

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

67Amostly conserved

82Cvariable

88Gvariable

106Cvariable

197Tmostly conserved

202Cvariable

206Tmostly conserved

217Amostly conserved

220Cmostly conserved

235Cmostly conserved

274Cmostly conserved

373Amostly conserved

400Cvariable

403Amostly conserved

407Cmostly conserved

442Tmostly conserved

493Tmostly conserved

533Tmostly conserved

535Amostly conserved

542Cmostly conserved

565Amostly conserved

589Cvariable

596Cmostly conserved

598Tmostly conserved

616Cvariable

628Gvariable

634Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes10

BINs3

Most divergent pair3.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix straminellasame genus2.7%Agonopterix coenosellasame genus3.5%Agonopterix kaekeritzianasame genus3.6%Agonopterix latipennellasame genus3.6%Agonopterix carduncellisame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type455 records

Wild obs. + sensor293

Museum / vouchered120

Other42

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 138≤1 km 72≤10 km 49>10 km 1

260 georeferenced · 33 without coordinates

Open the mapobservation + sensor293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 15≤1 km 66≤10 km 10

91 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	32
Tartu, EE	23
DanishLepidopterologicalSocietylocation not on record	12
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
SLU Artdatabankenlocation not on record	7
NHMOlocation not on record	7
Salzburg, AT	2
Durban Natural Science Museumlocation not on record	2
Stockholm, SE	2
Research Collection of Peter Lichtmanneckerlocation not on record	2
University of Kaiserslauternlocation not on record	1
Helsinki, FI	1
University of Oulu, Zoological Museumlocation not on record	1

13 institutions · 99 of 120 vouchered records shown · 21 without an institution code

09Environmental DNA42 detections

Where the DNA of Agonopterix pallorella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys3

Countries15

Verifiable raw sequence linked14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map15 countries0

edge woodland/meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 4.20–18.4

Seasonal swing summer↔winter16.9 °C

Max temp (day)15.0 °C 8.20–23.5

Min temp (night)7.70 °C 2.60–15.2

Precipitation52.1 mm/mo 28.5–111

Air humidity60.4 % 54.1–63.6

Moisture balance-40.8 mm/mo -70.1–37.4

Vapour deficit565 Pa 376–935

Wind speed3.90 m/s 2.50–6.30

Cloud cover41.7 % 33.7–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)