Agonopterix nigrinotella

(Busck, 1908) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records62

Data sources7

Biological traits0

DNA specimens28

eDNA detections31

Sources7 archives

Databases and archives Agonopterix nigrinotella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 2 countries31 detections

DNA & barcodingBOLD28 specimens

01Narrative

Agonopterix costimacula is a moth in the family Depressariidae. It was described by John Frederick Gates Clarke in 1941. The Global Lepidoptera Names Index lists it as a synonym of Agonopterix nigrinotella. It is found in North America, where it has been recorded from Maryland, Michigan, Ohio and Ontario. The wingspan is 21–25 mm. The forewings are ocherous-fuscous, the base and the costa to about the middle slightly lighter. The light basal area is followed by blackish-fuscous shading. There are two black discal spots at the basal third and a light whitish-ocherous discal spot, narrowly edged with fuscous, at the end of the cell. There are six to eight fuscous spots on the costa, as well as a series of smaller ones at the ends of the veins around the termen. The wing is irrorated (sprinkled) with black scales. The hindwings are light smoky fuscous, but lighter basally. The larvae feed on Ptelea trifolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix nigrinotella has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes1

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

58Cmostly conserved

267Gmostly conserved

615Tmostly conserved

624Tmostly conserved

627Tmostly conserved

640Cmostly conserved

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTACTAATTCGTGCTGAATTAGGAAATCCAGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes4

BINs2

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix omelkoisame genus4.0%Agonopterix invenustellasame genus4.2%Agonopterix ochrocephalasame genus4.2%Agonopterix irroratasame genus4.2%Agonopterix carduncellisame genus4.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor16

Museum / vouchered46

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 5≤1 km 5≤10 km 6

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
St. Paul, US	10
Washington, US	4
East Lansing, US	3
Cornell University Insect Collectionlocation not on record	1

5 institutions · 30 of 46 vouchered records shown · 16 without an institution code

09Environmental DNA31 detections

Where the DNA of Agonopterix nigrinotella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map2 countries0

Temperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.50 °C 6.10–21.0

Seasonal swing summer↔winter28.6 °C

Max temp (day)11.6 °C 11.2–25.1

Min temp (night)1.60 °C 1.50–17.3

Precipitation77.4 mm/mo 69.9–98.1

Air humidity55.8 % 55.1–58.7

Moisture balance-12.2 mm/mo -58.6–0.1

Vapour deficit424 Pa 419–999

Wind speed4.00 m/s 3.00–4.40

Cloud cover51.1 % 42.3–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)