Agonopterix nervosa

Haworth, 1812 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records3 141

Data sources9

Biological traits2

DNA specimens83

eDNA detections101

Sources9 archives

Databases and archives Agonopterix nervosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI101 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics83 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 141 records

Environmental DNA3 datasets · 14 countries101 detections

DNA & barcodingBOLD83 specimens

Genome at a glanceGoaT · NCBI≈592 Mbp

01Narrative

The gorse tip moth (Agonopterix nervosa) is a smallish moth species of the family Depressariidae.See references in Savela (2008) Caterpillar (right of center) emerging from foodplant An inflorescence of Oenanthe crocata with flowers drawn together by larva It is found in Europe and North America. The wingspan is 16–22 mm. Terminal joint of palpi with two blackish bands. Forewings are light brown, somewhat whitish-sprinkled, sometimes slightly reddish-tinged ; numerous dark fuscous dashes ; two indicating discal stigmata, between which is sometimes a line of pale scales ; an obscure pale very acutely angulated fascia at 3/4. Hindwings fuscous-whitish,more fuscous posteriorly ; 5 connate with stalk of 3 and 4.The larva is dark bluish -grey; lateral line orangeyellow;spots black, white-circled; head black; plate of 2 black, bisected, anterior edge whitish.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults fly from July to September depending on the location. The caterpillars feed on brooms, namely of the genera Cytisus, Genista, Laburnum (golden chains) and Ulex (gorses).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding83 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix nervosa has left across the world's sequence archives.

At a glance

DNA specimens83

BINs1

Marker genes1

eDNA detections101

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

368Gmostly conserved

544Amostly conserved

619Cmostly conserved

628Gmostly conserved

TACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes13

BIN1

Most divergent pair0.76%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix conciliatellasame genus3.5%Agonopterix carduncellisame genus4.3%Agonopterix straminellasame genus4.4%Agonopterix comitellasame genus4.4%Agonopterix kayseriensissame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agonopterix nervosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈592 055 879 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agonopterix nervosa0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Chromosome records30–602n range45median60mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 601×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.7% BUSCO

08Occurrence & distribution

Record type3 141 records

Wild obs. + sensor2 664

Museum / vouchered457

Other20

Origin

Native6

Range

Area of Occupancy AOO5 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 070≤1 km 526≤10 km 794>10 km 23

2 413 georeferenced · 251 without coordinates

Open the mapobservation + sensor2 664

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 199≤1 km 103≤10 km 69

371 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence457

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	186
NHMOlocation not on record	46
Tartu, EE	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	16
Essig Museum of Entomologylocation not on record	15
SLU Artdatabankenlocation not on record	13
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	11
NTNU-VMlocation not on record	10
Helsinki, FI	10
Provincia di Livornolocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Stockholm, SE	6
Washington, US	4
Uniwersytet Łódzkilocation not on record	4
Trondheim, NO	2
University of Kaiserslauternlocation not on record	2
Nijmegen, NL	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
Tilburg, NL	2
BioFokuslocation not on record	1
Philadelphia, US	1
ZSMlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Peter Buchnerlocation not on record	1
neflocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

29 institutions · 376 of 457 vouchered records shown · 81 without an institution code

09Environmental DNA101 detections

Where the DNA of Agonopterix nervosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found101

Studies independent surveys3

Countries14

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 101 detections have coordinates

Open the map14 countries0

inside forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 11.2–19.1

Seasonal swing summer↔winter13.8 °C

Max temp (day)19.8 °C 14.3–27.6

Min temp (night)12.6 °C 8.00–13.8

Precipitation67.7 mm/mo 2.60–121

Air humidity60.5 % 57.0–64.7

Moisture balance-30.1 mm/mo -150–46.0

Vapour deficit673 Pa 497–919

Wind speed2.70 m/s 1.80–4.20

Cloud cover37.9 % 23.3–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 100 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agonopterix nervosa

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 141 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 141 records