Agonopterix laterella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records149

Data sources7

Biological traits0

DNA specimens7

eDNA detections15

Sources7 archives

Databases and archives Agonopterix laterella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF149 records

Environmental DNA3 datasets · 5 countries15 detections

DNA & barcodingBOLD7 specimens

01Narrative

Agonopterix laterella is a moth of the family Depressariidae. It is found in most of Europe. The wingspan is 20–25 mm. Adults are on wing from July to March.microlepidoptera.nl The larvae feed on Centaurea cyanus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix laterella has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Avariable

31Amostly conserved

82Cvariable

88Avariable

157Cmostly conserved

271Tvariable

304Cvariable

340Cvariable

388Amostly conserved

400Tmostly conserved

401Cvariable

412Gvariable

517Tvariable

538Gvariable

541Avariable

571Tvariable

589Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACATCATTAAGATTATTAATTCGTGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes5

BINs2

Most divergent pair2.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix xeranthemellasame genus4.3%Agonopterix anticellasame genus4.7%Agonopterix ivinskisisame genus4.9%Agonopterix alpigenasame genus4.9%Agonopterix paraselinisame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor33

Museum / vouchered89

Other27

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 5≤1 km 4≤10 km 15

24 georeferenced · 9 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 2≤1 km 15≤10 km 43>10 km 5

65 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	50
DanishLepidopterologicalSocietylocation not on record	8
Natural History Museum Rotterdamlocation not on record	5
Chiba, JP	4
Provincia di Livornolocation not on record	4
Salzburg, AT	3
Tartu, EE	3
University of Kaiserslauternlocation not on record	3
Philadelphia, US	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Uniwersytet Łódzkilocation not on record	1

11 institutions · 84 of 89 vouchered records shown · 5 without an institution code

09Environmental DNA15 detections

Where the DNA of Agonopterix laterella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys3

Countries5

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 11.3–19.3

Seasonal swing summer↔winter19.2 °C

Max temp (day)20.0 °C 14.7–23.1

Min temp (night)13.4 °C 9.10–14.1

Precipitation77.6 mm/mo 35.4–128

Air humidity60.7 % 54.6–63.3

Moisture balance-29.6 mm/mo -122–16.6

Vapour deficit751 Pa 491–999

Wind speed3.30 m/s 2.30–4.50

Cloud cover49.0 % 27.3–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)