Agonopterix furvella

(Treitschke, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Agonopterix

At a glance

Occurrence records68

Data sources7

Biological traits0

DNA specimens21

eDNA detections1

Sources7 archives

Databases and archives Agonopterix furvella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD21 specimens

01Narrative

Agonopterix furvella is a moth of the family Depressariidae. It is found in France, Germany, Italy, Austria, the Czech Republic, Poland, Slovakia, Hungary, Croatia, Romania, Bulgaria, North Macedonia, Albania, Greece, Ukraine and Russia. Leaves of Dictamnus albus united by larva Larva The wingspan is 23–28 mm. The larvae feed on Dictamnus albus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonopterix furvella has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

14Amostly conserved

23Amostly conserved

26Tmostly conserved

67Gmostly conserved

533Tmostly conserved

634Tmostly conserved

636Cmostly conserved

639Tmostly conserved

640Cmostly conserved

642Tmostly conserved

643Amostly conserved

654Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGATTATTAATTCGGGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonopterix kayseriensissame genus4.1%Agonopterix straminellasame genus4.1%Agonopterix ochrocephalasame genus4.1%Agonopterix multiplicellasame genus4.4%Agonopterix ivinskisisame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor30

Museum / vouchered36

Other2

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 10≤1 km 1≤10 km 6

17 georeferenced · 13 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 22

22 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Provincia di Livornolocation not on record	22
ZSMlocation not on record	4
University of Vienna, Dept of Botany and Biodiversity Researchlocation not on record	1
University of Kaiserslauternlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

5 institutions · 29 of 36 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Agonopterix furvella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

dry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 18.7–18.7

Seasonal swing summer↔winter21.1 °C

Max temp (day)23.0 °C

Min temp (night)13.7 °C

Precipitation78.1 mm/mo

Air humidity57.1 %

Moisture balance-50.5 mm/mo

Vapour deficit925 Pa

Wind speed2.70 m/s

Cloud cover36.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)